Previous Article | Next Article 
Molecular and Cellular Biology, February 2008, p. 1041-1046, Vol. 28, No. 3
0270-7306/08/$08.00+0 doi:10.1128/MCB.01504-07
Copyright © 2008, American Society for Microbiology. All Rights Reserved.
Drosophila UTX Is a Histone H3 Lys27 Demethylase That Colocalizes with the Elongating Form of RNA Polymerase II
Edwin R. Smith,1
Min Gyu Lee,2
Benjamin Winter,1
Nathan M. Droz,1
Joel C. Eissenberg,3
Ramin Shiekhattar,2,4 and
Ali Shilatifard1*
Stowers Institute for Medical Research, 1000 East 50th Street, Kansas City, Missouri 64110,1
The Wistar Institute, 3601 Spruce Street, Philadelphia, Pennsylvania 19104,2
Edward A. Doisy Department of Biochemistry and Molecular Biology, Saint Louis University School of Medicine, 1402 South Grand Blvd., St. Louis, Missouri 63104,3
Centre de Regulacio Genomica Dr. Aiguader, 88 08003 Barcelona, Spain4
Received 18 August 2007/
Returned for modification 15 October 2007/
Accepted 5 November 2007

ABSTRACT
Histone H3 methylation at Lys27 (H3K27 methylation) is a hallmark
of silent chromatin, while H3K4 methylation is associated with
active chromatin regions. Here we report that a
Drosophila JmjC
family member, dUTX, specifically demethylates di- and trimethylated
but not monomethylated H3K27. dUTX localization on chromatin
correlates with the elongating form of RNA polymerase II (Pol
II), and dUTX can associate with Pol II. Furthermore, heat shock
induction results in the recruitment of dUTX to the hsp70 gene,
like that of several other Pol II elongation factors. Our data
indicate that dUTX is intimately associated with actively transcribed
genes and may provide a paradigm for how H3K27 demethylation
is required for the activation of preinitiated Pol II on transcriptionally
poised genes.

INTRODUCTION
Histone H3 methylation at lysine 27 (H3K27 methylation) is a
chromatin modification that is enriched at silent genes and
is mediated by Polycomb (PcG) group proteins (
24,
28). PcG proteins
are required for the stable maintenance of HOX gene silencing
during animal development. In contrast, the trithorax (trxG)
group of proteins mediates Lys4 methylation of H3 (H3K4 methylation),
which is associated with the maintenance of open chromatin at
HOX genes to ensure proper expression of these genes during
development (
28). The roles of these proteins in cellular memory,
together with the stability of histone methylation relative
to other histone modifications, have led to the assumption that
H3K4 and H3K27 methylation marks are also stable. However, the
recent discovery of histone lysine demethylases has led to a
reappraisal of the stability of many histone methylation marks
(
18,
25,
27).
Previously, we and others demonstrated that the trithorax group gene little imaginal discs (lid) encodes a JmjC domain-containing histone demethylase that demethylates trimethylated H3K4 (H3K4me3) (9, 22, 26). While lid is genetically classified as a trxG member in Drosophila melanogaster, a human homolog of Lid, Jarid1D, has been found to associate with PcG proteins (20), suggesting that the cellular machinery responsible for the maintenance of Lys27 methylation and gene silencing works, in part, by demethylation of the activating H3K4 trimethyl mark. In a continuing effort to understand the cellular and molecular functions of the JmjC demethylases, we have been studying the biochemical and genetic properties of these factors. In this article, we describe the initial characterization of the Drosophila UTX homolog, a JmjC domain-containing histone demethylase that demethylates H3K27me3, a mark associated with Polycomb repression. We find that dUTX is closely associated with RNA polymerase II (Pol II) on actively transcribed genes, including heat shock loci, suggesting a possible role for H3K27 demethylation on preinitiated Pol II on transcriptionally poised genes.

MATERIALS AND METHODS
Antibodies.
Commercially available antibodies used in this study are as
follows. Anti-mono-, di-, and trimethyl H3K27 (07448, 07452,
and 07449), anti-trimethyl H3K4 (07473), and anti-trimethyl
H3K9 (07442) were purchased from Upstate/Millipore. The anti-trimethyl
H3K36 (ab9050), anti-trimethyl H3K79 (ab2621), and anti-trimethyl
H4K20 (ab9053) antibodies were purchased from Abcam. The anti-FLAG
antibody (F3165) was from Sigma. H5 and H14 (recognizing Ser2-
and Ser5-phosphorylated Pol II) were purchased from Covance
(MMS-129R and MMS-134R). Rabbit anti-dUTX custom antibodies
were prepared against synthetic peptides at Pocono Rabbit Farm
and Lab. The dUTX immunogen was the peptide Gly-Val-Glu-Ile-Arg-Phe-Asn-Gly-Arg-Gly-Lys-Asn-Glu-Ala-Ser-His-Tyr-Cys.
The anti-dUTX antibody was affinity purified with Sulfolink
resin (Pierce) bearing the immunizing peptide by using the manufacturer's
protocol. Anti-HP1 monoclonal antibody C1A9 was a gift from
Sarah Elgin.
Immunofluorescence.
Salivary gland polytene chromosome squashing and staining were done essentially as previously described (8).
Immunoprecipitation.
Immunoprecipitations were done as previously described (30), using 0.35 M NaCl in the buffer for nuclear extraction and washing of immunoprecipitates.
Heat shock chromatin immunoprecipitation.
Dmel-2 cells, a derivative of Schneider line 2 from Invitrogen, were grown to near-confluence in a 100-mm-diameter dish in SFX insect medium (HyClone). For heat shock, the medium was removed from a dish of cells growing at room temperature, and 10 ml of fresh medium prewarmed to 37°C was added. Cells were placed in a 37°C incubator for 5 min. The medium was aspirated from the dish, and 10 ml of room temperature medium was added. Two hundred seventy microliters of 37% formaldehyde was added to the dish, and cells were fixed for 10 min at room temperature to ensure that heat-shocked and non-heat-shocked cells cross-linked with the same efficiency. Quenching with glycine and the rest of the chromatin immunoprecipitation procedure were done as previously described (29). Hsp70 primers at 1 kb into the hsp70 transcribed region were CATCGACGAGGGATCTCTGTTC and GGCGCGAGGGTTGGA (4). Rp49 primers were AGAGTTCTTGTAACGTGGTCGGAATA and CAATGGTGCTGCTATCCCAATC. DNA obtained from the chromatin immunoprecipitation was measured by SYBR green real-time PCR using a Bio-Rad iCycler.
Histone demethylation assay.
Bulk histones (4 µg; Sigma) were incubated with 1 to 2 µg of recombinant proteins in a histone demethylase assay buffer [20 mM Tris-HCl (pH 7.3), 150 mM NaCl, 100 µM (NH4)2(SO4)2, 1 mM
-ketoglutarate, 2 mM ascorbate, 5% glycerol, and 0.2 mM phenylmethylsulfonyl fluoride] in a final volume of 10 µl for 5 to 7 h at 37°C. The reaction mixture was analyzed by sodium dodecyl sulfate-polyacrylamide gel electrophoresis, followed by Western blotting.
Fly stocks and crosses.
The UTX RNA interference (RNAi) fly stock (5640-R-2) was obtained from the National Institute of Genetics (Japan) and corresponds to an upstream activation sequence-Gal4-driven 500-nucleotide hairpin targeting all known isoforms of CG5640 (dUTX). RNAi transgene males were crossed to yw; Act5c-Gal4/CyO, y+ females. For polytene staining from dUTX knockdown larvae, we chose male larvae with y– mouth hooks. Adult flies were used for knockdown and control Western blot analysis. Flies were separated on the basis of straight or curly wings.

RESULTS AND DISCUSSION
Recently, the human UTX protein has been shown to function as
an H3K27 demethylase (
21). In order to learn about the cellular
and molecular properties of this enzyme, we have identified
its
Drosophila homolog, dUTX (Fig.
1A). UTX was originally discovered
as an X-linked homolog of a ubiquitously transcribed gene on
the mammalian Y chromosome, UTY (
14). In addition to a C-terminal
JmjC domain, both UTX and UTY contain an N-terminal domain with
several tetratricopeptide repeats, versatile protein binding
modules found in a variety of proteins with diverse cellular
functions (
6). Remarkably, UTX was recently identified as a
component of trithorax-related MLL3 and MLL4 complexes that
mediate the methylation of H3 on lysine 4 (
5,
16). Together,
these findings reveal a new level of complexity in the regulation
of gene expression by Polycomb and trithorax proteins through
histone methylation and demethylation.
To determine whether dUTX is a histone demethylase in vitro,
recombinant dUTX was expressed in insect cells by using a baculovirus
expression system (Fig.
1B). dUTX specifically demethylated
di- and trimethylated but not monomethylated H3K27 when presented
with a mixture of total histones (Fig.
1C). Furthermore, dUTX
is not capable of removing other repressive chromatin marks,
such as H3K9me3 or H4K20me3, or the sites of methylation marks
correlated with active transcription, such as H3K4me3 and H3K36me3,
in vitro (Fig.
1C). While H3K27 di- and trimethylated forms
are found primarily at repressive chromatin sites, the monomethylated
form of H3K27 is found in coding regions of transcribed genes
(
3). Polycomb has a strong preference for binding the trimethylated
form of H3K27, suggesting that demethylation down to the di-
or monomethylated form could disrupt Polycomb binding (
10).
To ensure that the observed demethylase activity was intrinsic
to dUTX and not a copurifying protein, a dUTX mutant bearing
double mutations in the JmjC domain was engineered and expressed
in the baculovirus system (Fig.
1D). The purified mutant enzyme
lacked catalytic activity, demonstrating that dUTX is an H3K27
demethylase (Fig.
1E).
H3K27 methylation has been classically associated with the stable maintenance of transcriptional silencing. Therefore, it was of interest to determine the genomic distribution of dUTX. Anti-dUTX antibodies were made against a C-terminal peptide and tested for reactivity against full-length dUTX. The antibody recognized dUTX in SF21 cells infected with the Drosophila UTX baculovirus (Fig. 2A). To help validate the specificity of the antibodies, we used a dUTX-targeted RNAi transgenic line obtained from the National Institute of Genetics (Japan). Significant reductions in levels of immunostaining with an anti-dUTX antiserum were observed for knockdown compared to control polytene chromosomes from salivary glands (Fig. 2B to G). This RNAi line was also used to assess H3K27 methylation levels in extracts from adult flies. Modest levels of enrichment of H3K27 methylation were observed in total histones from adult flies after normalization to total-H3 levels (Fig. 2H). However, we were unable to detect significant changes in H3K27 methylation levels by immunofluorescence on polytene chromosomes of 3rd-instar larvae (data not shown). This may indicate that other factors in addition to dUTX are involved in H3K27 demethylation in vivo or that dUTX may function at specific loci throughout development.
Since dUTX staining appeared to occur in interband regions,
frequently sites of active transcription, we costained chromosomes
with antibodies recognizing elongating and paused forms of Pol
II (Fig.
3A to H). There was very extensive colocalization with
the elongating form of RNA polymerase (Ser2-phosphorylated C-terminal
domain [CTD]) and a lesser extent of colocalization with the
engaged but paused form of RNA polymerase (Ser5-phosphorylated
CTD). Although the Lys4 demethylase Lid also was present in
interband regions, it did not colocalize with the elongating
form of RNA polymerase (
22), demonstrating distinct biological
roles for these enzymes.
To test if dUTX could be recruited to a gene upon activation
similarly to other elongation factors that we and others have
tested (
1,
4,
11,
12,
31), we used the hsp70 gene as a model
inducible gene. Chromatin immunoprecipitation was performed
before heat shock and after 5 min of heat shock of Schneider
2 cells. Antibodies directed to dUTX and RNA polymerase both
immunoprecipitated increased levels of the hsp70 gene after
heat shock (Fig.
4A). Consistent with the chromatin immunoprecipitation
results from Schneider 2 cells, dUTX became highly enriched
at major heat shock loci (puffs) on polytene chromosomes (Fig.
4B to E). Furthermore, we demonstrated that dUTX in cell extracts
exists in complexes associated with Pol II (Fig.
4F).
The colocalization of an H3K27 demethylase with the elongating
form of RNA polymerase was unexpected but is emblematic of how
little we understand about the mechanisms of regulation of gene
expression by histone modifications. The recent finding that
human UTX associates with trithorax family members is consistent
with a role for dUTX at transcribing genes (
5,
16). Although
no direct evidence exists for demethylation of Lys27 in coding
regions, it is intriguing that a recent study found a large
number of genes with paused polymerases (
15). Lorincz and Schubeler
(
23) speculate that Polycomb group proteins could be responsible
for the pausing of these polymerases. In this context, our finding
of a Lys27 demethylase colocalizing with the elongating form
of RNA polymerase suggests that demethylation could be a key
step in the pathway by which these genes are activated.

ADDENDUM
While this article was under review, several groups reported
demethylase activity for UTX and the related enzyme JMJD3 in
humans (
2,
7,
17,
19,
32).

ACKNOWLEDGMENTS
We thank the National Institute for Genetics (Japan) for the
UTX RNAi fly stock.
J.C.E. was supported by grants from the U.S. National Science Foundation (MCB 0131414 and MCB 0615831). R.S. was supported by a grant from the U.S. National Institutes of Health (GM61204). A.S. was supported by grants from the U.S. National Institutes of Health (CA089455 and GM069905).

FOOTNOTES
* Corresponding author. Mailing address: Stowers Institute for Medical Research, 1000 East 50th Street, Kansas City, MO 64110. Phone: (816) 926-4465. Fax: (816) 926-2080. E-mail:
ASH{at}Stowers-Institute.org 
Published ahead of print on 26 November 2007. 

REFERENCES
1 - Adelman, K., W. Wei, M. B. Ardehali, J. Werner, B. Zhu, D. Reinberg, and J. T. Lis. 2006. Drosophila Paf1 modulates chromatin structure at actively transcribed genes. Mol. Cell. Biol. 26:250-260.[Abstract/Free Full Text]
2 - Agger, K., P. A. Cloos, J. Christensen, D. Pasini, S. Rose, J. Rappsilber, I. Issaeva, E. Canaani, A. E. Salcini, and K. Helin. 2007. UTX and JMJD3 are histone H3K27 demethylases involved in HOX gene regulation and development. Nature 449:731-734.[CrossRef][Medline]
3 - Barski, A., S. Cuddapah, K. Cui, T. Y. Roh, D. E. Schones, Z. Wang, G. Wei, I. Chepelev, and K. Zhao. 2007. High-resolution profiling of histone methylations in the human genome. Cell 129:823-837.[CrossRef][Medline]
4 - Boehm, A. K., A. Saunders, J. Werner, and J. T. Lis. 2003. Transcription factor and polymerase recruitment, modification, and movement on dhsp70 in vivo in the minutes following heat shock. Mol. Cell. Biol. 23:7628-7637.[Abstract/Free Full Text]
5 - Cho, Y. W., T. Hong, S. Hong, H. Guo, H. Yu, D. Kim, T. Guszczynski, G. R. Dressler, T. D. Copeland, M. Kalkum, and K. Ge. 2007. PTIP associates with MLL3- and MLL4-containing histone H3 lysine 4 methyltransferase complex. J. Biol. Chem. 282:20395-20406.[Abstract/Free Full Text]
6 - D'Andrea, L. D., and L. Regan. 2003. TPR proteins: the versatile helix. Trends Biochem. Sci. 28:655-662.[CrossRef][Medline]
7 - De Santa, F., M. G. Totaro, E. Prosperini, S. Notarbartolo, G. Testa, and G. Natoli. 2007. The histone H3 lysine-27 demethylase Jmjd3 links inflammation to inhibition of polycomb-mediated gene silencing. Cell 130:1083-1094.[CrossRef][Medline]
8 - Eissenberg, J. C. 2006. Functional genomics of histone modification and non-histone chromosomal proteins using the polytene chromosomes of Drosophila. Methods 40:360-364.[CrossRef][Medline]
9 - Eissenberg, J. C., M. G. Lee, J. Schneider, A. Ilvarsonn, R. Shiekhattar, and A. Shilatifard. 2007. The trithorax-group gene in Drosophila little imaginal discs encodes a trimethylated histone H3 Lys4 demethylase. Nat. Struct. Mol. Biol. 14:344-346.[CrossRef][Medline]
10 - Fischle, W., Y. Wang, S. A. Jacobs, Y. Kim, C. D. Allis, and S. Khorasanizadeh. 2003. Molecular basis for the discrimination of repressive methyl-lysine marks in histone H3 by Polycomb and HP1 chromodomains. Genes Dev. 17:1870-1881.[Abstract/Free Full Text]
11 - Gerber, M., J. Ma, K. Dean, J. C. Eissenberg, and A. Shilatifard. 2001. Drosophila ELL is associated with actively elongating RNA polymerase II on transcriptionally active sites in vivo. EMBO J. 20:6104-6114.[CrossRef][Medline]
12 - Gerber, M., K. Tenney, J. W. Conaway, R. C. Conaway, J. C. Eissenberg, and A. Shilatifard. 2005. Regulation of heat shock gene expression by RNA polymerase II elongation factor, Elongin A. J. Biol. Chem. 280:4017-4020.[Abstract/Free Full Text]
13 - Goetting-Minesky, M. P., and K. D. Makova. 2006. Mammalian male mutation bias: impacts of generation time and regional variation in substitution rates. J. Mol. Evol. 63:537-544.[CrossRef][Medline]
14 - Greenfield, A., L. Carrel, D. Pennisi, C. Philippe, N. Quaderi, P. Siggers, K. Steiner, P. P. Tam, A. P. Monaco, H. F. Willard, and P. Koopman. 1998. The UTX gene escapes X inactivation in mice and humans. Hum. Mol. Genet. 7:737-742.[Abstract/Free Full Text]
15 - Guenther, M. G., S. S. Levine, L. A. Boyer, R. Jaenisch, and R. A. Young. 2007. A chromatin landmark and transcription initiation at most promoters in human cells. Cell 130:77-88.[CrossRef][Medline]
16 - Issaeva, I., Y. Zonis, T. Rozovskaia, K. Orlovsky, C. M. Croce, T. Nakamura, A. Mazo, L. Eisenbach, and E. Canaani. 2007. Knockdown of ALR (MLL2) reveals ALR target genes and leads to alterations in cell adhesion and growth. Mol. Cell. Biol. 27:1889-1903.[Abstract/Free Full Text]
17 - Jepsen, K., D. Solum, T. Zhou, R. J. McEvilly, H. J. Kim, C. K. Glass, O. Hermanson, and M. G. Rosenfeld. 2007. SMRT-mediated repression of an H3K27 demethylase in progression from neural stem cell to neuron. Nature 450:415-419.[CrossRef][Medline]
18 - Klose, R. J., and Y. Zhang. 2007. Regulation of histone methylation by demethylimination and demethylation. Nat. Rev. Mol. Cell Biol. 8:307-318.[CrossRef][Medline]
19 - Lan, F., P. E. Bayliss, J. L. Rinn, J. R. Whetstine, J. K. Wang, S. Chen, S. Iwase, R. Alpatov, I. Issaeva, E. Canaani, T. M. Roberts, H. Y. Chang, and Y. Shi. 2007. A histone H3 lysine 27 demethylase regulates animal posterior development. Nature 449:689-694.[CrossRef][Medline]
20 - Lee, M. G., J. Norman, A. Shilatifard, and R. Shiekhattar. 2007. Physical and functional association of a trimethyl H3K4 demethylase and Ring6a/MBLR, a polycomb-like protein. Cell 128:877-887.[CrossRef][Medline]
21 - Lee, M. G., R. Villa, P. Trojer, J. Norman, K. P. Yan, D. Reinberg, L. Di Croce, and R. Shiekhattar. 2007. Demethylation of H3K27 regulates Polycomb recruitment and H2A ubiquitination. Science 318:447-450.[Abstract/Free Full Text]
22 - Lee, N., J. Zhang, R. J. Klose, H. Erdjument-Bromage, P. Tempst, R. S. Jones, and Y. Zhang. 2007. The trithorax-group protein Lid is a histone H3 trimethyl-Lys4 demethylase. Nat. Struct. Mol. Biol. 14:341-343.[CrossRef][Medline]
23 - Lorincz, M. C., and D. Schubeler. 2007. RNA polymerase II: just stopping by. Cell 130:16-18.[CrossRef][Medline]
24 - Ringrose, L., and R. Paro. 2004. Epigenetic regulation of cellular memory by the Polycomb and Trithorax group proteins. Annu. Rev. Genet. 38:413-443.[CrossRef][Medline]
25 - Schneider, J., and A. Shilatifard. 2006. Histone demethylation by hydroxylation: chemistry in action. ACS Chem. Biol. 1:75-81.[CrossRef][Medline]
26 - Secombe, J., L. Li, L. Carlos, and R. N. Eisenman. 2007. The Trithorax group protein Lid is a trimethyl histone H3K4 demethylase required for dMyc-induced cell growth. Genes Dev. 21:537-551.[Abstract/Free Full Text]
27 - Shi, Y. 2007. Histone lysine demethylases: emerging roles in development, physiology and disease. Nat. Rev. Genet. 8:829-833.[CrossRef][Medline]
28 - Shilatifard, A. 2006. Chromatin modifications by methylation and ubiquitination: implications in the regulation of gene expression. Annu. Rev. Biochem. 75:243-269.[CrossRef][Medline]
29 - Smith, E. R., C. D. Allis, and J. C. Lucchesi. 2001. Linking global histone acetylation to the transcription enhancement of X-chromosomal genes in Drosophila males. J. Biol. Chem. 276:31483-31486.[Abstract/Free Full Text]
30 - Smith, E. R., A. Pannuti, W. Gu, A. Steurnagel, R. G. Cook, C. D. Allis, and J. C. Lucchesi. 2000. The Drosophila MSL complex acetylates histone H4 at lysine 16, a chromatin modification linked to dosage compensation. Mol. Cell. Biol. 20:312-318.[Abstract/Free Full Text]
31 - Tenney, K., M. Gerber, A. Ilvarsonn, J. Schneider, M. Gause, D. Dorsett, J. C. Eissenberg, and A. Shilatifard. 2006. Drosophila Rtf1 functions in histone methylation, gene expression, and Notch signaling. Proc. Natl. Acad. Sci. USA 103:11970-11974.[Abstract/Free Full Text]
32 - Xiang, Y., Z. Zhu, G. Han, H. Lin, L. Xu, and C. D. Chen. 2007. JMJD3 is a histone H3K27 demethylase. Cell Res. 17:850-857.[CrossRef][Medline]
Molecular and Cellular Biology, February 2008, p. 1041-1046, Vol. 28, No. 3
0270-7306/08/$08.00+0 doi:10.1128/MCB.01504-07
Copyright © 2008, American Society for Microbiology. All Rights Reserved.
This article has been cited by other articles:
-
Andersson, R., Enroth, S., Rada-Iglesias, A., Wadelius, C., Komorowski, J.
(2009). Nucleosomes are well positioned in exons and carry characteristic histone modifications. Genome Res
19: 1732-1741
[Abstract]
[Full Text]
-
Tie, F., Banerjee, R., Stratton, C. A., Prasad-Sinha, J., Stepanik, V., Zlobin, A., Diaz, M. O., Scacheri, P. C., Harte, P. J.
(2009). CBP-mediated acetylation of histone H3 lysine 27 antagonizes Drosophila Polycomb silencing. Development
136: 3131-3141
[Abstract]
[Full Text]
-
Pauler, F. M., Sloane, M. A., Huang, R., Regha, K., Koerner, M. V., Tamir, I., Sommer, A., Aszodi, A., Jenuwein, T., Barlow, D. P.
(2009). H3K27me3 forms BLOCs over silent genes and intergenic regions and specifies a histone banding pattern on a mouse autosomal chromosome. Genome Res
19: 221-233
[Abstract]
[Full Text]
-
Yoh, S. M., Lucas, J. S., Jones, K. A.
(2008). The Iws1:Spt6:CTD complex controls cotranscriptional mRNA biosynthesis and HYPB/Setd2-mediated histone H3K36 methylation. Genes Dev.
22: 3422-3434
[Abstract]
[Full Text]
-
Yu, H., Zhu, S., Zhou, B., Xue, H., Han, J.-D. J.
(2008). Inferring causal relationships among different histone modifications and gene expression. Genome Res
18: 1314-1324
[Abstract]
[Full Text]