Previous Article | Next Article ![]()
Molecular and Cellular Biology, February 2008, p. 1068-1080, Vol. 28, No. 3
0270-7306/08/$08.00+0 doi:10.1128/MCB.00484-07
Copyright © 2008, American Society for Microbiology. All Rights Reserved.

Departments of Internal Medicine, Division of Molecular Oncology,1 Cell Biology and Physiology,2 Cancer Biology Pathway, Siteman Cancer Center, Washington University School of Medicine, St. Louis, Missouri 631103
Received 20 March 2007/ Returned for modification 11 May 2007/ Accepted 14 November 2007
|
|
|---|
|
|
|---|
Approximately half of the cell's energy expenditure is directed toward ribosome biogenesis (26). The nucleolus, long recognized as a marker for active cellular growth, was first described in the early 1960s as the center of ribosomal DNA (rDNA) transcription and ribosome biogenesis (6, 32). This organelle is composed of three regions, on the basis of morphology at the ultrastructural level: the fibrillar centers, the dense fibrillar compartment, and the granular zone. rDNA transcription occurs in the junction region between the fibrillar centers and the surrounding dense fibrillar component, and the resulting rRNA is further processed in the periphery of the dense fibrillar component. Further posttranscriptional modifications and assembly into subunits occur in the surrounding granular region (18).
While the primary mechanisms regulating these processes have been well studied in Saccharomyces cerevisiae (13), multicellular organisms demand more complex regulatory mechanisms, in that proliferative capacity is determined not only by the relative abundance of nutrients but also by complicated extracellular signals and growth factors. Indeed, previous studies have demonstrated convergence between the growth and the proliferation pathways via regulation of the tumor suppressor gene products Rb and p53 (9, 17, 43, 48). Both products are known to negatively regulate the activity of polymerase I in rDNA transcription. Oncogenes such as c-Myc also regulate the transcription of rDNA and the genes that encode ribosomal proteins, implying that an intricate network exists within the nucleolus to ensure the proper synthesis of ribosomes (7, 15, 16).
The tumor suppressor p19ARF represents an attractive candidate for coupling proliferation to growth. Given its nucleolar localization (39, 44, 45) and potent induction by hyperproliferative signals (19, 20, 31, 50), ARF represents a potential nucleolar integrator of growth signals coming into the cell. It has been regarded classically as an activator of p53 through its ability to sequester Mdm2, the E3 ubiquitin ligase for p53, in the nucleolus (39, 44, 45). However, recent data have demonstrated a role for ARF in binding to and affecting the function of the ribosomal chaperone nucleophosmin (NPM), independent of its ability to regulate p53 (4, 8, 21). Furthermore, these data are consistent with those from a growing number of studies with mice and humans that describe p53-independent functions for ARF tumor suppression (35).
Given ARF's nucleolar localization, its role in suppressing cellular growth and proliferation, and its ability to bind to a protein involved in ribosome biogenesis, we were inclined to explore the functional and physiological consequences of ARF disruption of growth and ribosome biogenesis. Through in vitro and in vivo assays, we utilized targeted Arf knockout mice and selective ARF knockdown via lentiviral RNA interference. Cells derived from Arf-null mice displayed significant alterations in gross nucleolar morphology and abundance and had a marked increase in basal protein synthesis levels compared to that in wild-type cells. Furthermore, this increase in protein synthesis was correlated to increased ribosome biogenesis and cytoplasmic ribosome content, implying a regulatory role for ARF in these processes. Importantly, though ARF levels are nearly undetectable in low-passage mouse embryonic fibroblasts (19), the knockdown of endogenous ARF via short hairpin RNA (shRNA) constructs mimicked the Arf-null nucleolar and ribosomal phenotype, implying an important ribosome homeostatic role for basal ARF proteins in wild-type cells. The progrowth phenotype of the Arf loss was not limited to proliferating cells, as fully differentiated osteoclasts from Arf-null mice exhibited tremendous gains in protein synthesis and overall activity in vivo. Mechanistically, all of the ribosome gains exhibited by the loss of Arf were reversed by the removal of the nucleolar NPM proto-oncogene, indicating that NPM, when untethered from ARF, promotes unrestrained ribosome biogenesis. Taken together, these data strongly argue for a moment-to-moment "thermostat"-like role for basal ARF molecules in controlling NPM-directed ribosome biogenesis and protein synthetic rates.
|
|
|---|
Cell culture, reagents, and antibodies.
Low-passage (2-5) MEFs were isolated and maintained in Dulbecco's modified Eagle's medium supplemented with 10% fetal bovine serum, 10 µg/ml gentamicin, 1x nonessential amino acids, 1 mM sodium pyruvate, and 2 mM glutamine. Rabbit anti-p16INK4A (sc-1207), goat anti-
-tubulin (catalog no. sc-7396), and rabbit anti-Myc (catalog no. sc-764) were purchased from Santa Cruz Biotechnology. Rat anti-p19ARF (catalog no. NB 200-169A) was purchased from Novus Biologicals. Mouse anti-NPM (catalog no. 32-5200) was purchased from Zymed.
Plasmid constructs. pLKO-GFP, a lentiviral shRNA expression vector was a generous gift from Sheila Stewart (Washington University). To construct the ARF shRNA vector, pLKO-GFP was digested with AgeI/MluI, and annealed oligonucleotides containing the shRNA target (nucleotides 157 to 177 of exon 1β of p19ARF) or a scrambled control were cloned into these sites. The resultant clones were verified by sequencing. The oligonucleotides used were small interfering ARF (siARF) sense (5'-CCGGGCTCTGGCTTTCGTGAACATGCTCGAGCATGTTCACGAAAGCCAGAGCTTTTTA-3'), siARF antisense (5'-CGCGTAAAAAGCTCTGGCTTTCGTGAACATGCTCGAG CATGTTCACGAAAGCCAGAGC-3'), siScrambled sense (5'-CCGGTACG ACCTGAACTGCTTAGGACTCGAGTCCTAAGCAGTTCAGGTCGTATTTTTA-3'), and siScrambled antisense (5'-CGCGTAAAAATACGACCTGAACTGCTTAGGACTCGAGTCCTAAGCAGTTCAGGTCGTA-3'). The underlined portions represent the 21 nucleotide hairpin sense and antisense strands. For NPM knockdown, annealed oligonucleotides were cloned as described above into pLKO-GFP, the sequences of which were previously reported (27). RNA interference for endogenous c-Myc was performed with siRNAs recognizing the 3' untranslated region (UTR) of c-Myc (5'-AACGTTTATAACAGTTACAAA-3' [Qiagen]). Myc-ER retrovirus was generated and used to infect wild-type and Arf-null MEFs as previously described (50).
AgNOR staining. MEFs were seeded onto glass coverslips overnight and were fixed and stained the following day. A silver nucleolar organizing region (AgNOR) staining method was modified from the protocol presented by Aubele et al. (1). Briefly, cells were fixed in 2% glutaraldehyde, followed by a postfixation in a 3:1 ethanol-acetic acid solution. Cells were stained with a 0.33% formic acid-33.3% silver nitrate solution in 0.66% gelatin and mounted on slides with Vectashield (Vector Labs).
Histomorphometry. Histomorphometric analysis was performed with OsteoQuant Nova Prime software (Bioquant Image Analysis Corp.) on images captured at x200 magnification by an Optitronics Magnifire camera on a Nikon TE300 microscope. Total numbers and total areas (µm2) of AgNOR regions per nucleus from 100 nuclei were assessed, and statistical significance was determined using Student's t test.
Electron microscopy. Asynchronously growing wild-type and Arf–/– MEFs were trypsinized and fixed with 2% glutaraldehyde in phosphate-buffered saline for 10 min. Samples were further processed by the Washington University Department of Cell Biology's Electron Microscopy Core. Pictures of nuclei and nucleoli were taken at magnifications of x3,000 and x7,000, respectively.
[35S]methionine incorporation assay. Cells (1 x 105) were seeded in triplicate and then starved of methionine and cysteine. Cells were pulsed with 14.3 µCi of [35S]methionine (Amersham) and then immediately washed twice with cold phosphate-buffered saline and lysed with 1% Triton X-100 buffer. Total protein was precipitated from lysates with 10% trichloroacetic acid. Pellets were subjected to liquid scintillation counting to measure the incorporated counts per minute.
Ribosome fractionation. Cells (2 x 106) were treated with 50 µg/ml cycloheximide prior to trypsinization and lysis, and fractionation was carried out over a 10 to 45% sucrose gradient (46). Gradients were fractionated, and RNA absorbance at 254 nm was monitored continuously to detect ribosomal subunits.
Lentiviral production and infection.
293T cells (5 x 105) were transfected with 1 µg of pLKO-GFP containing either scrambled or ARF shRNA cassettes along with the pHR8.2
R packaging vector and the pCMV-VSV-G envelope vector. Viral supernatants were collected and pooled. Wild-type MEFs (8 x 105) were plated and infected with viral supernatant containing 10 µg/ml protamine sulfate. Cells were infected again on the following day, checked for green fluorescent protein expression, and allowed to express the shRNA construct for 48 h.
Serum assays. Levels of tartrate-resistant acid phosphatase (TRAP) 5b were measured in serum collected from wild-type or Arf–/– mice, using a TRAP 5b enzyme-linked immunosorbent assay (ELISA) system (IDS, Fountain Hills, AZ).
Osteoclast formation assays.
Whole bone marrow was extracted from femurs and tibias of wild-type or Arf–/– mice and plated in CMG-14-12 culture supernatant (1/10 vol) in
-minimal essential medium (
-MEM) containing 10% fetal calf serum (FCS) to generate primary bone marrow macrophages (BMM), as described previously (49). Cells were fed every day with
-MEM containing 10% FCS, CMG-14-12 supernatant (1/20 vol), and glutathione S-transferase-RANK ligand (GST-RANKL) (100 ng/ml) and incubated for 5 days to generate osteoclasts (49). TRAP staining was performed according to the manufacturer's instructions (Sigma-Aldrich, St. Louis, MO). Five fields at a magnification of x4 were captured with the Magnafire system, and the TRAP-positive cells with three or more nuclei were counted by one blinded to the genotype. A quantitative TRAP solution assay was performed by adding a colorimetric substrate, 5.5 mM p-nitrophenyl phosphate, in the presence of 10 mM sodium tartrate at pH 4.5.
Macrophage proliferation assays.
BMMs (1 x 104) were plated in
-MEM containing 10% FCS and CMG-14-12 supernatant (1/10 vol). Cells were starved in
-MEM containing 0.1% FCS for 12 h. At this time,
-MEM containing 10% FCS and CMG-14-12 supernatant (1/10 vol) was added back to the cells. Cells were labeled with bromodeoxyuridine (BrdU) for 24 h, and proliferation was measured using the chemiluminescent cell proliferation ELISA (Roche Diagnostics, Mannheim, Germany).
Western blotting and serial immunoprecipitation.
MEF cell extracts (30 µg) were loaded onto 4 to 20% sodium dodecyl sulfate (SDS)-polyacrylamide gels (ISC Biosciences), transferred to polyvinylidene difluoride membrane (Millipore), and probed with antibody to rat anti-p19ARF (Novus Biologicals), goat anti-
-tubulin (Santa Cruz Biotechnology), rabbit anti-Myc (Santa Cruz Biotechnology), rabbit anti-p16INK4A (Santa Cruz Biotechnology), and rabbit anti-L5 (ILAMM). Secondary horseradish peroxidase-conjugated anti-rabbit, anti-goat, or anti-rat antibodies (Jackson ImmunoResearch) and ECL+ (Amersham) were used to visualize the bands. For serial immunoprecipitation, 200 µg of wild-type MEF lysate was immunoprecipitated with GammaBind (Amersham) by a custom-made rabbit NPM polyclonal antibody (Sigma Genosys) (46). The final supernatant was concentrated with a Vivaspin column (Vivascience), and all samples were loaded onto 10% SDS-polyacrylamide gels for immunoblotting analysis.
47S rRNA real-time reverse transcription-PCR. Levels of 47S rRNA transcripts were determined as described previously by Cui and Tseng (10). Briefly, total RNA was reverse transcribed with a mouse rRNA-specific primer (5'-CGTGGCATGAACACTTGG-3'). Real-time PCR was performed with iQ SYBR Green Supermix (Bio-Rad) according to the manufacturer's protocol, with the forward primer 5'-CTGACACGCTGTCCTTTCCC-3' and the reverse primer 5'-GTGAGCCGAAATAAGGTGGC-3' on an iCycler thermal cycler (Bio-Rad). The absolute copy number was obtained by comparison to serial dilutions of a known amount of plasmid containing the mouse rDNA repeat.
rRNA labeling experiments. Equal numbers of wild-type and Arf–/– MEFs were starved in methionine-free media containing 10% dialyzed fetal bovine serum. For uridine labeling, cells were labeled in medium containing 2.5 µCi/ml [3H]uridine (Amersham) and then chased in label-free medium. Where noted, cells were treated with 50 µCi/ml [methyl-3H]methionine (Amersham) for 30 min and chased in unlabeled methionine-containing (10 µM) media in the nuclear/cytoplasmic fractionation experiments. Total RNA was isolated using Trizol reagent (Invitrogen) and loaded onto 1% agarose-formaldehyde gels for the uridine experiments. Cellular fractionation was carried out using a nuclear extraction kit according to the manufacturer's protocol (Active Motif). Total RNA was isolated from the nuclear and cytoplasmic fractions using Trizol and loaded onto 1% agarose-formaldehyde gels. RNA was transferred to Hybond N+ membranes (Amersham), cross-linked, sprayed with En3Hance (Perkin-Elmer), and subjected to autoradiography.
|
|
|---|
![]() View larger version (75K): [in a new window] |
FIG. 1. Loss of ARF results in nucleolar morphological changes. (A) AgNOR staining of representative wild-type (WT) and Arf–/– MEFs. Increases in the number and irregularity of the AgNOR indices in the Arf–/– cells are shown. (B) Ultrastructural features of nuclei from the wild-type and Arf–/– MEFs. Arrows indicate nucleoli (x3,000) and fibrillar centers (x7,000). (C) Quantification of AgNOR indices from panel A. The left panel shows the number of AgNORs per nucleus (n = 100). The right panel shows the total nucleolar area (in µm2) per nucleus as determined by histomorphometric analysis (n = 100). *, P < 0.01.
|
![]() View larger version (72K): [in a new window] |
FIG. 2. Tissues from newborn Arf–/– mice display altered nucleolar morphology reminiscent of the in vitro findings. (A) AgNOR staining of representative sections from the intestine and liver. (B) Quantification of total AgNOR area per nucleus (n = 100). *, P < 0.01. WT, wild type.
|
![]() View larger version (17K): [in a new window] |
FIG. 3. Disruption of ARF enhances protein synthesis independent of cellular proliferation. (A) Cells were starved of methionine and cysteine for 30 min prior to the addition of a [35S]methionine label for the indicated times, followed by lysis, trichloroacetic acid precipitation of proteins, and liquid scintillation counting. (B) Equal numbers of cells (1 x 105) were plated in triplicate at day 0 and then were trypsinized and counted via a hemocytometer at various time points. (C) Cycloheximide (50 µg/ml) was added for 10 min prior to lysis and ultracentrifugation of cleared lysate on 10 to 40% sucrose gradients. The graph shows an A254 of ribosome subunits over increasing sucrose density. (D) Equal-passage MEFs (1 x 105) were trypsinized and analyzed by a Coulter Vi-Cell counter for cell volume. (E) Equal-passage MEFs (1 x106) were harvested and analyzed for protein content by a standard colorimetric DC assay. WT, wild type.
|
![]() View larger version (13K): [in a new window] |
FIG. 4. ARF regulates protein synthesis and ribosome biogenesis in vivo. (A) Livers were isolated from three wild-type (WT) and Arf-null littermates and briefly trypsinized. Cells (5 x 106) were immediately cultured in methionine-free medium for 15 min and then incubated with [35S]methionine for the indicated times. Proteins were trichloroacetic acid precipitated, and labeled proteins were quantified by liquid scintillation counting. (B) Spleens were isolated from three wild-type and Arf-null littermates. Cells (1 x 107) were immediately harvested, and cytosolic fractions were loaded onto 7 to 47% sucrose gradients for ultracentrifugation separation. Graph B shows an A254 of ribosome subunits over increasing sucrose density.
|
![]() View larger version (37K): [in a new window] |
FIG. 5. Acute depletion of p19ARF results in nucleolar, morphological, and functional changes reminiscent of the Arf–/– cells. (A) Western blotting confirmation of the p19ARF knockdown in wild-type (WT) MEFs 96 h postinfection with lentiviral shRNA constructs using antibodies recognizing -tubulin, NPM, rpL5, p19ARF, and p16INK4a. Expression change (n-fold) is marked under each panel. (B) AgNOR staining of representative MEFs infected with control (scrambled) or p19ARF-specific shRNA virus. (C) Quantification of AgNOR indices. Left panel shows the number of AgNORs per nucleus (n = 100). Right panel shows the total nucleolar area (in µm2) per nucleus as determined by histomorphometric analysis (n = 100). *, P < 0.01 (D) Total radioactivity incorporated after [35S]methionine pulse. Cells were starved of methionine and cysteine for 30 min prior to the addition of label for the indicated times, followed by lysis, trichloroacetic acid precipitation of proteins, and liquid scintillation counting. (E) Cycloheximide (50 µg/ml) was added for 10 min prior to lysis and ultracentrifugation of cleared lysate on 10 to 40% sucrose gradients. The graph shows an A254 of ribosome subunits over increasing sucrose density.
|
We first determined whether the proliferation rates varied between wild-type and Arf–/– BMM, osteoclast precursors. BrdU labeling of BMMs demonstrated no significant differences in the proliferation rates between wild-type and Arf–/– osteoclast precursors (Fig. 6A), similar to the equal proliferation rates of early passage MEFs (Fig. 3B). Next, BMMs from Arf–/– and wild-type mice were induced to produce mature osteoclasts by the addition of macrophage colony-stimulating factor (M-CSF) and RANKL. After 3 days of stimulation with RANKL, cells were fixed and stained with a TRAP substrate, an osteoclast-specific stain that relies on the abundance of TRAP protein produced by the osteoclast. An increased number of mature osteoclasts derived from the Arf–/– precursors was observed compared to that of the wild-type controls (Fig. 6B). TRAP-positive cells with greater than five nuclei were counted as a way to differentiate maturing osteoclasts from immature precursors and resulted in a significant increase in the Arf–/– genotype (149 versus 91 per well; n = 5; P = 0.01) (Fig. 6C).
![]() View larger version (69K): [in a new window] |
FIG. 6. Loss of p19ARF has functional consequences on osteoclast biology. (A) BrdU incorporation in the wild-type (WT) and Arf–/– macrophages. (B) Representative TRAP staining of equal numbers of BMMs following 3 days of treatment with M-CSF and RANKL reveals an increase in multinucleated osteoclasts formed from the Arf–/– precursors. (C) The graph shows increases in TRAP-positive osteoclasts with greater than five nuclei derived from the Arf–/– bone marrow. *, P = 0.01. (D) TRAP solution assay of equal numbers of TRAP-positive cells. Cells from the wild-type (day 4 post-RANKL addition) or the Arf–/– (day 3 post-RANKL addition) precursors were lysed and incubated in a colorimetric assay with p-nitrophenyl phosphate, a substrate for TRAP. The graph shows an A405. *, P = 0.01. (E) Levels of serum TRAP 5b in Arf–/– compared to that in wild-type mice (P = 0.03; n = 5 mice in each group) as measured by ELISA.
|
Loss of Arf increases rRNA transcription, rRNA processing, and ribosome nuclear export. Previous reports have demonstrated a role for ARF in rRNA processing (37). Furthermore, our laboratory has previously demonstrated ARF's inhibitory activity on the shuttling of NPM (8) and NPM's nucleolar cargo, rpL5 and 5S rRNA (46). Additional reports have demonstrated a role for nucleolar ARF in preventing rDNA transcription through both Myc-dependent and -independent mechanisms (2, 3, 30). Taken together, nucleolar ARF could prevent all three steps in ribosome biogenesis: transcription, processing, and export. The loss of Arf had no impact on the levels of either NPM or rpL5, suggesting that ARF's effect on this pathway was not due to altered synthesis and/or destruction of these proteins (Fig. 7A). Moreover, serial immunodepletion of NPM revealed two distinct pools of ARF: one that is effectively associated with NPM (Fig. 7B, lane 1) and a second pool that is free from NPM (Fig. 7B, lane 6). This implies that ARF's effects on ribosome biogenesis may not be relegated to only NPM-dependent processes and is consistent with the idea that ARF antagonizes rDNA transcription through other unique, physically interacting proteins. Accordingly, the loss of Arf resulted in a fourfold increase in 47S rRNA transcription (Fig. 7C), a process thought to be independent of direct NPM regulation (as NPM does not localize to the fibrillar compartment of the nucleolus).
![]() View larger version (57K): [in a new window] |
FIG. 7. ARF exerts its effects through the control of rRNA synthesis and processing. (A) Western blotting demonstrates that the Arf–/– MEFs do not have alterations in the levels of nucleolar proteins NPM and ribosomal protein L5. (B) Serial NPM immunoprecipitation. Wild-type cells were lysed and serially immunoprecipitated (five times) with mouse NPM antibodies. The final supernatant was concentrated and was included as a control for non-NPM binding proteins. (C) Total RNA was collected from equal numbers of asynchronously dividing cells, and quantitative real-time RT-PCR was performed with a primer specific to the mouse 47S transcript. (D) The wild-type (WT) and Arf–/– cells were pulsed with a [3H]uridine label for 30 min, followed by a chase with label-free medium for the indicated times. Total RNA was isolated from equal cell numbers, loaded onto formaldehyde-containing agarose gels, and transferred to membranes for fluorography. (E) Cells were labeled with [methyl-3H]methionine, followed by a chase with medium containing excess unlabeled methionine for the indicated times. Total RNA was isolated, and equal radioactive counts were loaded onto gels and transferred to membranes for fluorography. CPM, counts per minute.
|
To determine the precise step at which ARF might influence rRNA processing, we labeled cells with [methyl-3H]methionine, which labels rRNA, and loaded equal amounts of the radioactive label to examine processing intermediates after short time periods of chase with label-free media. We observed only a modest increase of the 32S rRNA precursors in cells lacking Arf at early time periods, indicating that ARF may interfere with the processing steps between the 47S transcript and the 32S intermediate (Fig. 7E). However, after 2 h of chase, we saw no differences in the relative amounts of radioactivity in the final 18S and the 28S products, indicating that the loss of Arf had no impact on these downstream processing steps. These results exactly mirror what Sugimoto and colleagues observed when they overexpressed ARF, namely, an accumulation of improperly processed rRNA intermediates between the 47S and 32S stages (37), albeit to a far lesser extent in our experiments.
As a final step in ribosome biogenesis, mature ribosome subunits are exported to the cytosol in a process that we have previously attributed to NPM-directed nuclear export (27, 46). The Arf-null MEFs exhibited a more robust (
25-fold) nuclear export of newly processed rRNAs than the wild-type cells did (Fig. 8A). Again, this extreme difference between the wild-type and the Arf-null cells was far greater than any previous step in ribosome biogenesis (e.g., transcription or processing), implying that each step represents an amplification of the previous step. This was most evident when the real-time nuclear export of rRNAs, as monitored by scintillation counting of newly exported 3H-labeled rRNA, revealed that the absolute rates of rRNA export were threefold increased in cells lacking Arf (Fig. 8B). Taking these data together, we believe this reflects the ability of ARF to regulate moment-to-moment steps in ribosome biogenesis, such that alterations in ARF levels may produce robust and rapid responses that effect cytoplasmic ribosomal content.
![]() View larger version (28K): [in a new window] |
FIG. 8. Nucleocytoplasmic shuttling of newly synthesized ribosomes is enhanced in the absence of Arf. (A) Equal numbers of cells were pulsed with [methyl-3H]methionine and chased with unlabeled methionine-containing medium for the indicated times. Total RNA was isolated from nuclear (N) and cytoplasmic (C) fractions and subjected to fluorography. (B) Cytoplasmic fractions from the indicated times were also subjected to liquid scintillation counting to obtain a quantitative estimate of total cytoplasmic rRNA. Inset, scatter plot of data presented in panel B with best-fit lines to indicate the velocity of export. m = slope. WT, wild type.
|
![]() View larger version (19K): [in a new window] |
FIG. 9. Myc is not required for the enhanced rDNA transcription of the Arf-null MEFs. the Arf–/– MEFs (2 x 106) transduced with siLuc control siRNAs or Myc siRNAs in the absence or presence of Myc-ER expressing retroviruses and 4-hyrodxytamoxifen were harvested and (A) immunoblotted with antibodies recognizing c-Myc or -tubulin. (B) RNA was isolated from the above cells and real-time PCR using 47S rRNA probes was performed in triplicate. WT, wild type.
|
![]() View larger version (28K): [in a new window] |
FIG. 10. NPM is required for ribosome gains in the absence of Arf. The Arf–/– MEFs (2 x 106) infected with lentiviruses encoding scrambled or NPM shRNAs were (A) lysed and immunoblotted with antibodies recognizing NPM and -tubulin; (B) lysed and RNA isolated for real-time PCR using 47S rRNA probes; (C) labeled with [methyl-3H]methionine, followed by a chase with medium containing excess unlabeled methionine for the indicated times, isolation of total RNA and equal radioactive counts, loading onto gels, and transfer to membranes for fluorography; (D) fractionated into nuclear (N) and cytosolic (C) lysates and immunoblotted with lamin A/C and SOD or Northern blotted with probes recognizing the 18S rRNA; or (E) starved of methionine and cysteine for 30 min prior to the addition of label for the indicated times, followed by lysis, trichloroacetic acid precipitation of proteins, and liquid scintillation counting. *, P < 0.01.
|
![]() View larger version (61K): [in a new window] |
FIG. 11. Loss of NPM expression inhibits osteoclastogenesis in the Arf –/– cells. (A) Western blotting of macrophages infected with either control or lentivirus-targeted shRNA specific to NPM to confirm the gene knockdown. (B) TRAP staining of osteoclasts differentiated in vitro with RANKL and M-CSF for 6 days. (C) TRAP activity assay of equal numbers of osteoclasts from the indicated genotypes. *, P < 0.01. WT, wild type.
|
|
|
|---|
In the past few years, numerous p53-independent functions have been ascribed to ARF (35). We found that nearly half of the basal ARF in the cell is in a complex with NPM, a protein previously shown to interact with human and mouse ARF proteins (4, 8, 21). While much of the work concerning the ARF-NPM interaction has focused on the ability of each protein to antagonize the function of the other (4, 8, 21, 24, 46), our findings suggest that the baseline interaction functions to maintain a controlled level of ribosome biogenesis. We propose a model where basal ARF antagonizes a small pool of NPM, either directly or enzymatically (8, 38), and thereby constantly limits ribosome output from the nucleolus. Importantly, levels of NPM did not change in the absence of ARF, but rather NPM activity was greatly increased as measured by its ability to promote ribosome nuclear export. Consistent with this model, the knockdown of basal NPM proteins resulted in dramatic reductions in protein production independent of cell proliferation, again underscoring the need for a consistent level of "ARF-free" NPM to promote ribosome synthesis.
While the mechanism and nature of such inhibition are still unclear, our data are consistent with a "thermostat" function for ARF, in that small changes in the abundance of ARF cause its binding partners to either dampen or enhance ribosome synthesis and export and, ultimately, lead to global changes in protein synthesis. It is apparent from our data that basal ARF can act in three distinct steps: (i) rDNA transcription, (ii) rRNA processing, and (iii) rRNA nuclear export.
While NPM has been ascribed roles in both rRNA processing and nuclear export (36, 47), we are uncertain of its ability to regulate rDNA transcription. In fact, NPM and ARF are both found in the granular region of the nucleolus, relatively far removed from the sites of nucleolar rDNA transcription (8). However, we did observe significantly enhanced transcription of 47S rRNA in the absence of Arf, implying that ARF proteins might regulate this process either directly or indirectly. This is not unprecedented, given recent findings that human ARF interacts with topoisomerase I to inhibit rDNA transcription (3, 23). Additionally, nearly half of the basal ARF protein is not bound to NPM, and we therefore cannot rule out the possibility that this pool of ARF is bound to proteins involved in rDNA transcription.
We suggest that ARF is expressed at a low level in interphase cells to ensure that proper growth control is achieved. This would serve to keep the cell in metabolic check, preventing the cell from wasting energy on unnecessary protein synthesis. Disruption of this exquisite basal ARF control would then have a twofold effect: (i) cells would produce far too many ribosomes, resulting in tremendous gains in protein synthesis, and (ii) the resultant cells would be highly susceptible to oncogenic signals. This setting would seem to provide a selective advantage to premalignant cells by ramping up their growth and, in the presence of appropriate signals, their proliferation. In support of this hypothesis, a recent study on the methylation of key loci involved in colorectal carcinogenesis demonstrated that 32% of the adenomas (premalignant lesions) isolated from patients with sporadic colorectal cancer demonstrated abnormalities at the Arf locus (11). Our findings represent a novel and important role for basal ARF in maintaining protein synthetic homeostasis in nonmalignant cells. While NPM is certainly required for much of the ribosome biogenesis gains observed for Arf-deficient cells, other interesting nucleolar targets of basal ARF must certainly exist. Precise details of how they may be affected remain elusive. Understanding the nucleolar integration of disparate requirements for proliferation, growth, and ribosome biogenesis will deepen our knowledge of how proteins like ARF adapted from regulators of cellular homeostasis to bona fide tumor suppressors.
A.J.A. is a recipient of a grant-in-aid from the Department of Defense Breast Cancer Research Program (BC030793). L.B.M. is supported by the Department of Defense Prostate Cancer Research Program award number W81XWH-04-0909. A.J.S. and M.K. are supported by the Siteman Cancer Biology Pathway. J.D.W. thanks the Pew Charitable Trusts and is a recipient of grants-in-aid from the Susan G. Komen for the Cure and National Institutes of Health (GM066032).
Published ahead of print on 10 December 2007. ![]()
|
|
|---|
This article has been cited by other articles:
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Copyright © 2010 by the American Society for Microbiology. For an alternate route to Journals.ASM.org, visit: http://intl-journals.asm.org | More Info»