![[Feedback]](/icons/banner/feedbackACT.gif){kind=icon}
![[For Subscribers]](/icons/banner/subscriberACT.gif){kind=icon}
![[Archive]](/icons/banner/archiveACT.gif){kind=icon}
![[Search]](/icons/banner/searchACT.gif){kind=icon}
![[Contents]](/icons/banner/tocACT.gif){kind=icon}
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Melissa N. Hinman,1
Robert A. Hasman,1
Priyesh Mehta,1 and
Hua Lou1,2,3*
Department of Genetics,1 Center for RNA Molecular Biology,2 Case Comprehensive Cancer Center, School of Medicine, Case Western Reserve University, Cleveland, Ohio 441063
Received 20 August 2007/ Returned for modification 4 September 2007/ Accepted 27 November 2007
 |
ABSTRACT |
|---|
 Top ABSTRACT INTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
|
INTRODUCTION |
|---|
|
TopABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
Exon 23a is an in-frame exon encoding 21 amino acids in the NF1 GAP region. This exon is alternatively included, producing two NF1 isoforms (5). The type I isoform does not contain this exon, while the type II isoform does. The ratio of the two isoforms varies in different tissues and during development. The type I isoform is predominantly expressed in neurons of the adult central nervous system (21, 25) and shows 10-times-higher activity in down-regulating Ras activity than the type II isoform (5, 48). In the pheochromocytoma cell line PC12, production of the NF1 type 1 isoform can be induced by nerve growth factor treatment (48). These lines of evidence suggest that a balance of the two isoforms is important during neuronal differentiation. Indeed, when exon 23a was deleted from the NF1 locus by gene targeting in mice, the mutant mice showed learning disabilities (16). To date, the molecular mechanism that controls this biologically important alternative splicing event has not been elucidated.
Here, we identify the Hu proteins as regulators of NF1 exon 23a splicing. Hu proteins are a family of highly conserved RNA-binding proteins that play an important role in neuronal differentiation (1, 2, 7, 46). Four members of the Hu protein family have been identified: HuA (also known as HuR), HuB (also known as Hel-N1), HuC, and HuD. With the exception of HuA, all of the Hu proteins are expressed predominantly in neurons (37). At the molecular level, Hu proteins, which all share a similar structure consisting of three RNA recognition motifs (RRMs) and a hinge domain between RRM2 and -3, regulate mRNA stability and translation in the cytoplasm (6, 8, 18, 27, 29, 31) and polyadenylation site selection in the nucleus (51, 53). In this report, we demonstrate that Hu proteins regulate skipping of NF1 exon 23a, through binding to intronic AU-rich sequence elements located on either side of the regulated exon. Overexpression of Hu proteins in nonneuronal cells promotes the inclusion of exon 23a from either the transfected reporter or the endogenously expressed NF1 pre-mRNA. More importantly, we elucidate the molecular mechanism by which Hu proteins suppress inclusion of this exon. We show that splicing repression requires at least two AU-rich sequences in the flanking introns. Upon binding at the AU-rich sequence downstream from the 5' splice site of this exon, Hu proteins interfere with U1 and U6 snRNP binding by competing with the positive splicing factors TIA-1/TIAR, which promote inclusion of exon 23a. In addition, we demonstrate that Hu proteins reduce binding of U2AF65 to an RNA containing the 3' splice site of exon 23a. In addition to providing new insights into the regulated expression of the NF1 gene, these studies provide definitive evidence to support a role for Hu proteins as splicing regulators and reveal a novel mechanism for regulating neuron-specific alternative splicing events.
|
MATERIALS AND METHODS |
|---|
|
TopABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
Immunoprecipitation (IP) of CA77 nuclear extract and RT-PCR analysis. Eight hundred micrograms of CA77 cell nuclear extract proteins was immunoprecipitated with anti-Hu sera in NET supplemented with RNase Out (Invitrogen). The pellet was washed five times in NET, treated with proteinase K, and extracted with phenol-chloroform (1:1), followed by RNA precipitation. Reverse transcription-PCR (RT-PCR) was carried out as described previously (52). Oligonucleotides used for RT-PCR were NF1 5'-5 and NF1 3'-4 for rat NF1 (in intron 23 and intron 23a, respectively) and GAPDH 5' and GAPDH 3' for rat GAPDH (glyceraldehyde-3-phosphate dehydrogenase) (in intron 3 and exon 5, respectively).
Plasmids. The human NF1 reporter constructs used in transfection experiments consisted of NF1 exon 23a with part of the flanking introns inserted into the first intron of the human metallothionein (HMT) gene. To generate reporters HMT-NF1 863/499 and HMT-NF1 75/499, the human NF1 sequence was PCR amplified from HeLa cell genomic DNA using an upstream oligonucleotide (NF1 5'-1 or NF1 5'-2) and a downstream oligonucleotide (NF1 3'-1). The PCR products were digested with BglII and BamHI and cloned into the RSV-HMT reporter linearized with BglII. The mutant reporters with the AU-rich sequence mutated were generated by a PCR-mediated mutagenesis procedure. The plasmids used to generate in vitro transcribed RNA substrates for UV cross-linking and psoralen cross-linking assays were generated by PCR using the transfection reporter plasmid as the template and oligonucleotides NF1 5'-3 and NF1 3'-2. The PCR product was restriction digested with EcoRI and HindIII and cloned into pGEM-3Zf(+) (Promega) vector digested with EcoRI and HindIII. Oligonucleotide sequences are shown in Table 1.
|
Cell culture, cell transfection, and antibiotic selection. HeLa and PC12 cell lines were maintained according to the ATCC instructions. CA77 cells (a gift from Alison Hall and Andrew Russo) were cultured in Dulbecco's modified Eagle medium/F-12 (Invitrogen) supplemented with 10% fetal bovine serum (Invitrogen) and 1% penicillin/streptomycin (Invitrogen). HeLa cells were transfected as previously described (52). Transfection of CA77 cells was carried out essentially as for HeLa cells except that Lipofectamine 2000 (Invitrogen) was used and cells were grown for 72 h instead of 48 h after transfection. Cotransfections were carried out using 1 µg of the NF1 reporter plasmid and 0.5 to 1 µg of polypyrimidine tract binding protein (PTB), TIAR, or mHuC plasmids. Stable transfection of PC12 cells was carried out using 5 µg of pcDNA3.1HisB vector, PTB, or mHuC. Forty-eight hours after transfection, the PC12 cells were selected with 500 µg/ml Geneticin (Invitrogen) for 7 days. The surviving cells were collected for further analysis.
RNA and protein analysis. Procedures for total RNA and protein isolation and RT-PCR analysis were described previously (52). Oligonucleotide pairs DS8/HMT3 and NF1 5'-4/NF1 3'-3 were used to analyze the NF1 reporter RNA and endogenous NF1 RNA, respectively. Sixteen to 20 and 19 to 21 PCR cycles were used to analyze reporter RNA isolated from HeLa or CA77 cells, respectively. Endogenous NF1 RNA in all of the cell lines was analyzed using 26 PCR cycles. Quantification of exon inclusion was determined using a PhosphorImager. The results shown are representative of at least three independent transfections for each experiment. The effect of PTB, TIAR, and Hu proteins on RNA processing of the reporter pre-mRNA was calculated as a percentage of the NF1 exon 23a inclusion [exon 23a inclusion/(exon 23a inclusion + exon 23a exclusion)]. Western blot analysis using the proteins isolated from the transfected cells was carried out with anti-Xpress antibody (Invitrogen), anti-Myc antibody (Invitrogen), or antihemagglutinin antibody (Covance).
siRNA-mediated knockdown of TIA-1, TIAR, or HuC. The TIA-1 and TIAR small interfering RNA (siRNA) duplexes were synthesized based on the information described by Izquierdo et al. (26) (Dharmacon). The target sequences are AAGCUCUAAUUCUGCAACUCUUU (TIA-1) and AACCAUGGAAUCAACAAGGAUUU (TIAR). One hundred twenty-five picomoles of each or both of the two siRNAs was used in these transfections, using DharmaFECT 1 (Dharmacon). The target sequence of HuC is AAUGAAUCCUGCAAGUUGGUU. Increasing amounts (150 and 300 pmol) of this siRNA were used to cotransfect the CA77 cells with the NF1 reporter.
In vitro assays. UV cross-linking reactions were carried out as described previously (52). Cross-linked polypeptides were immunoprecipitated using monoclonal antibodies against TIA-1/TIAR, Hu sera (a gift from Jerome Posner), or anti-U2AF65 antibody (Sigma U4758). Psoralen cross-linking assays were carried out as described in a previous report (52). GST-TIAR and GST-mHuB SV4 recombinant proteins were added to the HeLa nuclear extract.
The RNA GST pull-down assay was carried out in a volume of 100 µl containing 44% HeLa cell nuclear extract, 2 mM ATP, 20 mM creatine phosphate, 0.15 mM dithiothreitol, 4 µg of either GST or GST-mHuB proteins, and 1 x 106 cpm of 32P-labeled RNA substrate. Reaction mixtures were incubated at 30°C for 20 min and then incubated with glutathione-Sepharose beads (Amersham) in NET supplemented with RNase Out (Invitrogen). The pellet was washed five times in NET and treated with proteinase K, followed by phenol-chloroform extraction and ethanol precipitation. The isolated RNA was analyzed on a 5% polyacrylamide gel containing 8.3 M urea.
Preparation of nuclear extracts from HeLa and CA77 cells and immunodepletion of TIA-1/TIAR proteins from HeLa nuclear extract. HeLa cell nuclear extracts were prepared using S3 suspension culture and standard techniques (52). To make nuclear extracts from CA77 cells, 100 100-mm dishes of CA77 monolayer cells were collected and used according to a standard procedure (52).
TIA-1 and TIAR proteins were depleted from HeLa nuclear extract by incubating nuclear extract with GammaBind G Sepharose (Amersham) coated with antibodies against TIA-1 and TIAR at 4°C for 30 min on a rocker. After a quick spin, the supernatant was transferred to a fresh tube. This procedure was carried out three times in total to achieve significant depletion.
|
RESULTS |
|---|
|
TopABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
|
The NF1 gene is widely expressed in normal adult human and rodent tissues tested, with most cells expressing the type II NF1 mRNA including exon 23a. The type I NF1 mRNA, in which exon 23a is skipped, is found predominantly in adult neurons (Fig. 1a) (21, 24). To study splicing regulation of NF1 exon 23a, we chose two cell lines, HeLa and CA77, to mimic the two splicing pathways. These cell lines are excellent models to study this alternative splicing event because the NF1 gene is endogenously expressed in both cell lines but its transcript is differentially processed. Exon 23a is predominantly included in HeLa cells to produce type II NF1 and excluded in CA77 cells to produce type I NF1 (Fig. 1c).
As shown in Fig. 1c, the neuron-specific HuB, HuC, and HuD proteins are expressed in CA77 cells but not in HeLa cells. The other member of the Hu protein family, HuA (HuR in human), is a ubiquitously expressed protein that shows similar levels of expression in both cell lines (not shown). These experiments indicate a correlation between neuron-specific Hu protein expression and exon 23a skipping.
Hu proteins suppress inclusion of NF1 exon 23a. In order to study how NF1 exon 23a inclusion is regulated, an NF1 reporter was generated by inserting NF1 exon 23a with part of its flanking intronic sequences into the first intron of the HMT gene (Fig. 1d). When transfected into HeLa or CA77 cells, the pre-mRNA generated from this reporter is processed similarly to the endogenous NF1 (compare lane 1 in each panel of Fig. 1d to Fig. 1c). In both cell lines, cotransfection of an Xpress-tagged mHuC cDNA plasmid with the NF1 reporter decreased inclusion of exon 23a of the reporter (Fig. 1d, middle and right panels). In contrast, overexpression of PTB, a general splicing suppressor that binds to pyrimidine-rich sequences, did not affect inclusion of this exon (Fig. 1d, left panel).
Overexpression of Hu proteins also decreased inclusion of exon 23a of the endogenous NF1 pre-mRNA. In HeLa cells, in spite of the relatively low transfection efficiency (20 to 40%, determined by transfection of a LacZ expression plasmid followed by X-Gal [5-bromo-4-chloro-3-indolyl-β-D-galactopyranoside] staining [data not shown]), mHuC consistently suppressed inclusion of exon 23a in the endogenous NF1 mRNA, leading to decreased production of the type II isoform (from 82% to 60%) (Fig. 2a). We also tested the effect of Hu proteins on endogenous NF1 splicing in the rat pheochromocytoma cell line PC12. This cell line was previously used to study the function of NF1 in regulating Ras activity during cell differentiation (48). In contrast to HeLa cells, PC12 cells favor skipping of NF1 exon 23a (Fig. 2b). In this experiment, PC12 cells were stably transfected with PTB, mHuC, or a control vector plasmid because the transfection efficiency is much lower in PC12 cells than in HeLa cells. After selection, the surviving cells were pooled and total RNA purified for RT-PCR splicing assays. Compared to the vector and PTB, introduction of mHuC significantly reduced inclusion of exon 23a from the endogenously expressed NF1 pre-mRNA (from 39% to 17%) (Fig. 2b).
|
|
TIA-1/TIAR protein promotes inclusion of NF1 exon 23a. The observation that the mutant reporter carrying point mutations at the downstream sequence showed moderately reduced exon inclusion in HeLa cells in the absence of any overexpressed proteins compared to the wild-type reporter (81% versus 68%) suggests that this AU-rich sequence may also function as a positive element (compare lanes 1 to 5 in Fig. 3b, left). Since TIA-1/TIAR proteins are known to bind similar sequences as the Hu proteins and affect exon inclusion positively (17, 20, 32), we hypothesized that TIA-1/TIAR function as splicing enhancer proteins to promote exon 23a inclusion. To test this hypothesis, we carried out overexpression and siRNA knockdown experiments to manipulate the levels of these proteins. When TIAR protein was overexpressed, inclusion of exon 23a of the reporter pre-mRNA was increased from 82% to 96% in HeLa cells (Fig. 4a, left panel) and from 29% to 44% in CA77 cells (Fig. 4a, right panel). As expected, when the downstream element was disrupted, the mutant reporter transcript did not respond to an increased level of TIAR (Fig. 4a, middle panel).
|
To further establish the function mediated by Hu and TIA-1/TIAR proteins through binding at the downstream AU-rich sequence, we generated a shorter reporter that contains only 75 nucleotides of intron sequence upstream of exon 23a and the same amount of downstream intron sequence (Fig. 5a). Inspection of the remaining upstream intron sequence in this reporter reveals no AU-rich sequence, whereas at least three clusters of AU-rich sequence elements are present in the downstream 499-nucleotide intron sequence in the reporter. The RNA transcripts of this new short reporter still responded well to increased levels of either TIAR or mHuC protein (Fig. 5a). However, the transcript from the mutant reporter in which the downstream AU-rich element was disrupted did not respond to increased levels of either TIAR or mHuC (Fig. 5b), suggesting that the AU-rich sequence downstream of the 5' splice site of exon 23a is a major determinant of the effect caused by either TIAR or mHuC in the short reporter background.
|
|
Finally, we carried out an siRNA knockdown experiment in CA77 cells. In this experiment, when the NF1 reporter was cotransfected with siRNA against HuC, a small yet consistent increase of exon 23a inclusion was observed (Fig. 6e, left panel). Because of the extremely low transfection efficiency in CA77 cells, we performed a control experiment in which HeLa cells were transfected with the siRNA against HuC, which showed that it is capable of reducing the level of exogenously expressed HuC protein (Fig. 6e, right panel). Note that the absolute levels of exon 23a inclusion in CA77 cells vary from transfection to transfection (between 21 and 40%), but the relative levels of exon 23a inclusion between constructs containing a wild-type or mutant sequence remain the same.
TIA-1/TIAR and Hu proteins modulate the interaction of U1 snRNP and U6 snRNP with the 5' splice site of exon 23a. The experiments discussed above demonstrate that TIA-1/TIAR proteins are positive regulatory factors promoting exon 23a inclusion and that Hu proteins are negative regulatory factors that decrease exon 23a inclusion. We next wished to investigate the underlying mechanisms by which these proteins regulate inclusion of this exon. It is well established that TIA-1/TIAR proteins regulate a number of splicing events by facilitating the interaction of U1 snRNP with suboptimal 5' splice sites (17, 20). The 5' splice site sequence (UCA/GTAAGTT) of the NF1 exon 23a is relatively weak due to the presence of UCA instead of the consensus of CAG as the last three nucleotides of the exon. Thus, we tested whether TIA-1/TIAR promotes interaction of U1 snRNP with the 5' splice site and, more importantly, whether Hu proteins suppress inclusion of NF1 exon 23a by interfering with binding of snRNPs to the 5' splice site.
A psoralen cross-linking assay was used to examine the interaction of snRNPs with the in vitro-transcribed RNA substrate described in Fig. 6a, using HeLa cell nuclear extract with or without supplementary recombinant TIAR or Hu proteins. One major cross-linked product that is nuclear extract dependent was observed (Fig. 7a). When recombinant GST-TIAR was added to the nuclear extract, the yields of this cross-linked product and an additional cross-linked doublet that moved faster in the nondenaturing gel were significantly increased (Fig. 7b, compare lanes 4 and 5 to lane 1). The increase of these cross-linked products is specific to the TIAR portion of the recombinant protein because GST alone did not affect the cross-linking yield (Fig. 7b, compare lanes 4 and 5 to lanes 2 and 3). The identity of the cross-linked products was determined by pretreatment of the nuclear extract with anti-snRNA oligoribonucleotides to block binding by specific snRNAs. The appearance of both cross-linked products is abolished by anti-U1 snRNA oligoribonucleotide, while only the faster-moving product depends on U6 snRNA (Fig. 7b, lanes 6 and 8), indicating that the slower-moving product contains U1 snRNA and the faster-moving product contains U6 snRNA. Interestingly, Hu proteins had the opposite effect in modulating U1 and U6 snRNA binding. Addition of GST-mHuB led to reduced U1 and U6 snRNA binding (Fig. 7b, lanes 9 and 10). This effect is specific to the full-length mHuB protein. A truncated GST-mHuB that contains only the RRM1 and RRM2 domains of the three-RRM-domain-containing protein had no effect on snRNA binding (Fig. 7b, lanes 11 and 12).
|
Hu proteins reduce U2AF65 binding to an RNA containing the upstream 3' splice site. The experiments discussed above indicate that Hu proteins affect recognition of the 5' splice site of exon 23a. We next tested whether Hu proteins would affect binding of splicing factors to the 3' splice site of this exon, using a longer RNA transcript this time to include the upstream AU-rich sequences. As shown in Fig. 8, addition of recombinant mHuB, but not a truncated mHuB that contains RRM1 and -2 only, to the HeLa nuclear extract reduced binding of U2AF65 to this RNA transcript. Note that the slight increase of U2AF65 binding in the presence of the truncated HuB at low concentration is not consistently observed. These results suggest that Hu proteins affect exon definition by preventing binding of splicing factors on both sides of exon 23a.
|
|
DISCUSSION |
|---|
|
TopABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
Regulation of neuron-specific alternative splicing. The studies presented in this report provide compelling evidence to support a role for Hu proteins in regulating alternative splicing and strongly suggest that Hu proteins are important splicing regulators in neurons. Hu proteins are one of only a few groups of neuron-specific splicing regulators identified thus far, including nPTB/brPTB, NAPOR/CUGBP2, Fox-1/Fox-2, Nova, and QK1 (9, 19, 28, 35, 39, 42, 44, 45, 47, 49, 50; reviewed in reference 33). We predict that, like Nova-2, which was shown to coordinately regulate alternative splicing of a network of genes related to synapsis (44), Hu proteins may regulate exon inclusion of numerous mRNAs by affecting alternative splicing of their pre-mRNAs. It is therefore of particular importance to identify additional targets of Hu proteins. Interestingly, in a recent report, HuD was implicated in regulation of Ikaros alternative splicing mediated by Notch3 signaling. In that study, HuD was shown to be up-regulated through T-cell receptor signaling, which is correlated with changes in several alternatively spliced isoforms of Ikaros (10). It is possible that HuD plays a direct role in splicing of the Ikaros pre-mRNA, although this remains to be definitively shown (26).
We demonstrate that inclusion of NF1 exon 23a is regulated in part by competition between Hu proteins and a group of previously characterized proteins, TIA-1/TIAR. TIA-1/TIAR proteins have been shown to bind to U-rich sequences immediately downstream of 5' splice sites of internal exons (17, 20, 26, 32). Although one study demonstrated that binding of TIA-1 is U1 dependent, other studies showed that TIA-1/TIAR proteins promote the interaction of U1 snRNP and 5' splice sites that contain suboptimal splicing signals (17, 20, 26, 32). In the NF1 system, we found that TIA-1/TIAR promote U1 snRNP interaction with the 5' splice site of exon 23a, consistent with the idea that TIA-1/TIAR proteins help define 5' splice sites. More interestingly, we found a novel function for these proteins in modulating U6 snRNP interaction with the same 5' splice site (Fig. 7). Furthermore, the interaction of U6 snRNP with the NF1 RNA substrate appears to be independent of U2 snRNP (Fig. 7b). This result suggests that TIA-1/TIAR proteins may promote splicing at multiple stages during spliceosome assembly, at the E complex and formation of a later complex, most likely the B complex. It was shown previously that B complex formation is blocked by an exonic splicing silencer in the CD45 system (23). Additional experiments using complete splicing substrates need to be carried out to provide definitive mechanistic insights.
Importantly, we show that by binding to the AU-rich sequence downstream of the 5' splice site of exon 23a, Hu proteins inhibit the function of TIA-1/TIAR, thereby reducing the interaction of U1 and U6 snRNPs with the 5' splice site. The nature of the competition of Hu and TIA-1/TIAR proteins is not clear at present. Although the data in Fig. 6c suggest competitive binding between the two groups of proteins at some level, we cannot rule out the possibility that they can bind to the AU-rich sequence simultaneously. Collectively, the results of these experiments and previous studies that demonstrate competition between TIA-1/TIAR and other splicing regulators such as PTB (26, 41, 54) strongly suggest that the balance between alternative splicing regulators represents a key theme of alternative splicing regulation in neurons.
Complex regulation of inclusion of exon 23a. Our results indicate that, in addition to competing with TIA-1/TIAR to regulate inclusion of exon 23a, Hu proteins suppress the inclusion of NF1 exon 23a through an additional mechanism. When the AU-rich sequence upstream of the 5' splice site of exon 23a was mutated, the mutant primary transcripts of the HMT-NF1 reporter responded to the increased Hu protein level to a much lesser extent (Fig. 3b). It has been observed in a number of systems, including Nova, PTB, and hnRNP A1, that splicing regulators function through binding at multiple sites (3, 4, 22, 36, 43). ELAV, the Drosophila homolog of the Hu proteins, also regulates alternative splicing by binding to multiple separate sites of the Neuroglian pre-mRNA (34). In the case of NF1 exon 23a, it is possible that the downstream binding site of Hu proteins plays a major role in controlling 5' splice site recognition, while the upstream binding site regulates 3' splice site recognition (Fig. 9). As a result, Hu proteins block exon definition of exon 23a during splicing.
|
The results of the mutagenesis study shown in Fig. 3 suggest that very complex regulatory mechanisms control the cell-specific inclusion of the NF1 exon 23a. The fact that mutants in which the downstream AU-rich sequence is disrupted have significantly reduced inclusion of exon 23a in CA77 cells but not in HeLa cells suggests the involvement of additional factors. We predict the existence of either additional positive factors present in HeLa cells or additional negative factors in CA77 cells. In the future, more detailed mutagenesis analysis will be carried out to address this issue.
It is commonly observed that alternatively spliced exons are subject to complex control. In fact, the term "splicing code" was recently used to describe the ever-growing number of examples in which multiple splicing enhancer and silencer elements coexist to fine-tune the regulated inclusion of a particular exon. This paradigm is supported by a large number of conventional gene-specific studies as well as recent global splicing analyses using computational and array-type approaches (12). A remaining challenge is to decipher the details of the "splicing code," identify the corresponding tissue-specific trans-acting factors, and define how the activities of different factors are coordinated to achieve tissue- and/or developmental stage-specific regulation for each alternative splicing event.
|
ACKNOWLEDGMENTS |
|---|
This work was supported by an NSF grant (MCB-0237685) and an NIH grant (NS-049103-01) to Hua Lou. Hui Zhu was supported by a predoctoral fellowship from the American Heart Association (0415086B). Melissa Hinman is supported by a genetics training grant from NIH (T32GM008613).
|
FOOTNOTES |
|---|
Published ahead of print on 17 December 2007.
Present address: Genomic Medicine Institute, Cleveland Clinic Foundation, 9500 Euclid Ave., Cleveland, OH 44195.
|
REFERENCES |
|---|
|
TopABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
2. Akamatsu, W., H. J. Okano, N. Osumi, T. Inoue, S. Nakamura, S. Sakakibara, M. Miura, N. Matsuo, R. B. Darnell, and H. Okano. 1999. Mammalian ELAV-like neuronal RNA-binding proteins HuB and HuC promote neuronal development in both the central and the peripheral nervous systems. Proc. Natl. Acad. Sci. USA 96:9885-9890.
3. Amir-Ahmady, B., P. L. Boutz, V. Markovtsov, M. L. Phillips, and D. L. Black. 2005. Exon repression by polypyrimidine tract binding protein. RNA 11:699-716.
4. An, P., and P. J. Grabowski. 2007. Exon silencing by UAGG motifs in response to neuronal excitation. PLoS Biol. 5:e36.[CrossRef][Medline]
5. Andersen, L. B., R. Ballester, D. A. Marchuk, E. Chang, D. H. Gutmann, A. M. Saulino, J. Camonis, M. Wigler, and F. S. Collins. 1993. A conserved alternative splice in the von Recklinghausen neurofibromatosis (NF1) gene produces two neurofibromin isoforms, both of which have GTPase-activating protein activity. Mol. Cell. Biol. 13:487-495.
6. Anderson, K. D., M. A. Morin, A. Beckel-Mitchener, C. D. Mobarak, R. L. Neve, H. M. Furneaux, R. Burry, and N. I. Perrone-Bizzozero. 2000. Overexpression of HuD, but not of its truncated form HuD I+II, promotes GAP-43 gene expression and neurite outgrowth in PC12 cells in the absence of nerve growth factor. J. Neurochem. 75:1103-1114.[CrossRef][Medline]
7. Anderson, K. D., J. Sengupta, M. Morin, R. L. Neve, C. F. Valenzuela, and N. I. Perrone-Bizzozero. 2001. Overexpression of HuD accelerates neurite outgrowth and increases GAP-43 mRNA expression in cortical neurons and retinoic acid-induced embryonic stem cells in vitro. Exp. Neurol. 168:250-258.[CrossRef][Medline]
8. Antic, D., N. Lu, and J. D. Keene. 1999. ELAV tumor antigen, Hel-N1, increases translation of neurofilament M mRNA and induces formation of neurites in human teratocarcinoma cells. Genes Dev. 13:449-461.
9. Ashiya, M., and P. J. Grabowski. 1997. A neuron-specific splicing switch mediated by an array of pre-mRNA repressor sites: evidence of a regulatory role for the polypyrimidine tract binding protein and a brain-specific PTB counterpart. RNA 3:996-1015.[Abstract]
10. Bellavia, D., M. Mecarozzi, A. F. Campese, P. Grazioli, C. Talora, L. Frati, A. Gulino, and I. Screpanti. 2007. Notch3 and the Notch3-upregulated RNA-binding protein HuD regulate Ikaros alternative splicing. EMBO J. 26:1670-1680.[CrossRef][Medline]
11. Bernards, A. 1995. Neurofibromatosis type 1 and Ras-mediated signaling: filling in the GAPs. Biochim. Biophys. Acta 1242:43-59.[Medline]
12. Blencowe, B. J. 2006. Alternative splicing: new insights from global analyses. Cell 126:37-47.[CrossRef][Medline]
13. Cichowski, K., and T. Jacks. 2001. NF1 tumor suppressor gene function: narrowing the GAP. Cell 104:593-604.[CrossRef][Medline]
14. Costa, R. M., N. B. Federov, J. H. Kogan, G. G. Murphy, J. Stern, M. Ohno, R. Kucherlapati, T. Jacks, and A. J. Silva. 2002. Mechanism for the learning deficits in a mouse model of neurofibromatosis type 1. Nature 415:526-530.[CrossRef][Medline]
15. Costa, R. M., and A. J. Silva. 2002. Molecular and cellular mechanisms underlying the cognitive deficits associated with neurofibromatosis 1. J. Child Neurol. 17:622-629, 646-651.
16. Costa, R. M., T. Yang, D. P. Huynh, S. M. Pulst, D. H. Viskochil, A. J. Silva, and C. I. Brannan. 2001. Learning deficits, but normal development and tumor predisposition, in mice lacking exon 23a of Nf1. Nat Genet. 27:399-405.[CrossRef][Medline]
17. Del Gatto-Konczak, F., C. F. Bourgeois, C. Le Guiner, L. Kister, M. C. Gesnel, J. Stevenin, and R. Breathnach. 2000. The RNA-binding protein TIA-1 is a novel mammalian splicing regulator acting through intron sequences adjacent to a 5' splice site. Mol. Cell. Biol. 20:6287-6299.
18. Deschenes-Furry, J., N. Perrone-Bizzozero, and B. J. Jasmin. 2006. The RNA-binding protein HuD: a regulator of neuronal differentiation, maintenance and plasticity. Bioessays 28:822-833.[CrossRef][Medline]
19. Dredge, B. K., and R. B. Darnell. 2003. Nova regulates GABA(A) receptor 
2 alternative splicing via a distal downstream UCAU-rich intronic splicing enhancer. Mol. Cell. Biol. 23:4687-4700.
20. Forch, P., O. Puig, N. Kedersha, C. Martinez, S. Granneman, B. Seraphin, P. Anderson, and J. Valcarcel. 2000. The apoptosis-promoting factor TIA-1 is a regulator of alternative pre-mRNA splicing. Mol. Cell 6:1089-1098.[CrossRef][Medline]
21. Gutmann, D. H., Y. Zhang, and A. Hirbe. 1999. Developmental regulation of a neuron-specific neurofibromatosis 1 isoform. Ann. Neurol. 46:777-782.[CrossRef][Medline]
22. Han, K., G. Yeo, P. An, C. B. Burge, and P. J. Grabowski. 2005. A combinatorial code for splicing silencing: UAGG and GGGG motifs. PLoS Biol. 3:e158.[CrossRef][Medline]
23. House, A. E., and K. W. Lynch. 2006. An exonic splicing silencer represses spliceosome assembly after ATP-dependent exon recognition. Nat. Struct. Mol. Biol. 13:937-944.[CrossRef][Medline]
24. Huynh, D. P., T. Nechiporuk, and S. M. Pulst. 1994. Alternative transcripts in the mouse neurofibromatosis type 2 (NF2) gene are conserved and code for schwannomins with distinct C-terminal domains. Hum. Mol. Genet. 3:1075-1079.
25. Huynh, D. P., T. Nechiporuk, and S. M. Pulst. 1994. Differential expression and tissue distribution of type I and type II neurofibromins during mouse fetal development. Dev. Biol. 161:538-551.[CrossRef][Medline]
26. Izquierdo, J. M., N. Majos, S. Bonnal, C. Martinez, R. Castelo, R. Guigo, D. Bilbao, and J. Valcarcel. 2005. Regulation of Fas alternative splicing by antagonistic effects of TIA-1 and PTB on exon definition. Mol. Cell 19:475-484.[CrossRef][Medline]
27. Jain, R. G., L. G. Andrews, K. M. McGowan, P. H. Pekala, and J. D. Keene. 1997. Ectopic expression of Hel-N1, an RNA-binding protein, increases glucose transporter (GLUT1) expression in 3T3-L1 adipocytes. Mol. Cell. Biol. 17:954-962.[Abstract]
28. Jensen, K. B., B. K. Dredge, G. Stefani, R. Zhong, R. J. Buckanovich, H. J. Okano, Y. Y. Yang, and R. B. Darnell. 2000. Nova-1 regulates neuron-specific alternative splicing and is essential for neuronal viability. Neuron 25:359-371.[CrossRef][Medline]
29. Keene, J. D. 1999. Why is Hu where? Shuttling of early-response-gene messenger RNA subsets. Proc. Natl. Acad. Sci. USA 96:5-7.
30. Klose, A., M. R. Ahmadian, M. Schuelke, K. Scheffzek, S. Hoffmeyer, A. Gewies, F. Schmitz, D. Kaufmann, H. Peters, A. Wittinghofer, and P. Nurnberg. 1998. Selective disactivation of neurofibromin GAP activity in neurofibromatosis type 1. Hum. Mol. Genet. 7:1261-1268.
31. Kullmann, M., U. Gopfert, B. Siewe, and L. Hengst. 2002. ELAV/Hu proteins inhibit p27 translation via an IRES element in the p27 5'UTR. Genes Dev. 16:3087-3099.
32. Le Guiner, C., F. Lejeune, D. Galiana, L. Kister, R. Breathnach, J. Stevenin, and F. Del Gatto-Konczak. 2001. TIA-1 and TIAR activate splicing of alternative exons with weak 5' splice sites followed by a U-rich stretch on their own pre-mRNAs. J. Biol. Chem. 276:40638-40646.
33. Li, Q., J. A. Lee, and D. L. Black. 2007. Neuronal regulation of alternative pre-mRNA splicing. Nat. Rev. Neurosci 8:819-831.[CrossRef][Medline]
34. Lisbin, M. J., J. Qiu, and K. White. 2001. The neuron-specific RNA-binding protein ELAV regulates neuroglian alternative splicing in neurons and binds directly to its pre-mRNA. Genes Dev. 15:2546-2561.
35. Markovtsov, V., J. M. Nikolic, J. A. Goldman, C. W. Turck, M. Y. Chou, and D. L. Black. 2000. Cooperative assembly of an hnRNP complex induced by a tissue-specific homolog of polypyrimidine tract binding protein. Mol. Cell. Biol. 20:7463-7479.
36. Oberstrass, F. C., S. D. Auweter, M. Erat, Y. Hargous, A. Henning, P. Wenter, L. Reymond, B. Amir-Ahmady, S. Pitsch, D. L. Black, and F. H. Allain. 2005. Structure of PTB bound to RNA: specific binding and implications for splicing regulation. Science 309:2054-2057.
37. Okano, H. J., and R. B. Darnell. 1997. A hierarchy of Hu RNA binding proteins in developing and adult neurons. J. Neurosci. 17:3024-3037.
38. Pascale, A., P. A. Gusev, M. Amadio, T. Dottorini, S. Govoni, D. L. Alkon, and A. Quattrone. 2004. Increase of the RNA-binding protein HuD and posttranscriptional up-regulation of the GAP-43 gene during spatial memory. Proc. Natl. Acad. Sci. USA 101:1217-1222.
39. Polydorides, A. D., H. J. Okano, Y. Y. Yang, G. Stefani, and R. B. Darnell. 2000. A brain-enriched polypyrimidine tract-binding protein antagonizes the ability of Nova to regulate neuron-specific alternative splicing. Proc. Natl. Acad. Sci. USA 97:6350-6355.
40. Quattrone, A., A. Pascale, X. Nogues, W. Zhao, P. Gusev, A. Pacini, and D. L. Alkon. 2001. Posttranscriptional regulation of gene expression in learning by the neuronal ELAV-like mRNA-stabilizing proteins. Proc. Natl. Acad. Sci. USA 98:11668-11673.
41. Shukla, S., F. Del Gatto-Konczak, R. Breathnach, and S. A. Fisher. 2005. Competition of PTB with TIA proteins for binding to a U-rich cis-element determines tissue-specific splicing of the myosin phosphatase targeting subunit 1. RNA 11:1725-1736.
42. Ule, J., K. B. Jensen, M. Ruggiu, A. Mele, A. Ule, and R. B. Darnell. 2003. CLIP identifies Nova-regulated RNA networks in the brain. Science 302:1212-1215.
43. Ule, J., G. Stefani, A. Mele, M. Ruggiu, X. Wang, B. Taneri, T. Gaasterland, B. J. Blencowe, and R. B. Darnell. 2006. An RNA map predicting Nova-dependent splicing regulation. Nature 444:580-586.[CrossRef][Medline]
44. Ule, J., A. Ule, J. Spencer, A. Williams, J. S. Hu, M. Cline, H. Wang, T. Clark, C. Fraser, M. Ruggiu, B. R. Zeeberg, D. Kane, J. N. Weinstein, J. Blume, and R. B. Darnell. 2005. Nova regulates brain-specific splicing to shape the synapse. Nat. Genet. 37:844-852.[CrossRef][Medline]
45. Underwood, J. G., P. L. Boutz, J. D. Dougherty, P. Stoilov, and D. L. Black. 2005. Homologues of the Caenorhabditis elegans Fox-1 protein are neuronal splicing regulators in mammals. Mol. Cell. Biol. 25:10005-10016.
46. Wakamatsu, Y., and J. A. Weston. 1997. Sequential expression and role of Hu RNA-binding proteins during neurogenesis. Development 124:3449-3460.[Abstract]
47. Wu, J. I., R. B. Reed, P. J. Grabowski, and K. Artzt. 2002. Function of quaking in myelination: regulation of alternative splicing. Proc. Natl. Acad. Sci. USA 99:4233-4238.
48. Yunoue, S., H. Tokuo, K. Fukunaga, L. Feng, T. Ozawa, T. Nishi, A. Kikuchi, S. Hattori, J. Kuratsu, H. Saya, and N. Araki. 2003. Neurofibromatosis type I tumor suppressor neurofibromin regulates neuronal differentiation via its GTPase-activating protein function toward Ras. J. Biol. Chem. 278:26958-26969.
49. Zhang, L., W. Liu, and P. J. Grabowski. 1999. Coordinate repression of a trio of neuron-specific splicing events by the splicing regulator PTB. RNA 5:117-130.[Abstract]
50. Zhang, W., H. Liu, K. Han, and P. J. Grabowski. 2002. Region-specific alternative splicing in the nervous system: implications for regulation by the RNA-binding protein NAPOR. RNA 8:671-685.[Abstract]
51. Zhu, H., R. A. Hasman, V. A. Barron, G. Luo, and H. Lou. 2006. A nuclear function of Hu proteins as neuron-specific alternative RNA processing regulators. Mol. Biol. Cell 17:5105-5114.
52. Zhu, H., R. A. Hasman, K. M. Young, N. L. Kedersha, and H. Lou. 2003. U1 snRNP-dependent function of TIAR in the regulation of alternative RNA processing of the human calcitonin/CGRP pre-mRNA. Mol. Cell. Biol. 23:5959-5971.
53. Zhu, H., H. L. Zhou, R. A. Hasman, and H. Lou. 2007. Hu proteins regulate polyadenylation by blocking sites containing U-rich sequences. J. Biol. Chem. 282:2203-2210.
54. Zuccato, E., E. Buratti, C. Stuani, F. E. Baralle, and F. Pagani. 2004. An intronic polypyrimidine-rich element downstream of the donor site modulates cystic fibrosis transmembrane conductance regulator exon 9 alternative splicing. J. Biol. Chem. 279:16980-16988.
This article has been cited by other articles:
| |||||||||||||||||||||||||
