This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Geiger, T. R.
Right arrow Articles by Nyborg, J. K.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Geiger, T. R.
Right arrow Articles by Nyborg, J. K.

 Previous Article  |  Next Article 

Molecular and Cellular Biology, February 2008, p. 1383-1392, Vol. 28, No. 4
0270-7306/08/$08.00+0     doi:10.1128/MCB.01657-07
Copyright © 2008, American Society for Microbiology. All Rights Reserved.

The Human T-Cell Leukemia Virus Type 1 Tax Protein Confers CBP/p300 Recruitment and Transcriptional Activation Properties to Phosphorylated CREB{triangledown}

Timothy R. Geiger, Neelam Sharma, Young-Mi Kim, and Jennifer K. Nyborg*

Department of Biochemistry and Molecular Biology, Campus Box 1870, Colorado State University, Fort Collins, Colorado 80523

Received 6 September 2007/ Returned for modification 29 October 2007/ Accepted 26 November 2007


arrow
ABSTRACT
 
The human T-cell leukemia virus-encoded oncoprotein Tax is a potent activator of viral transcription. Tax function is strictly dependent upon the cellular transcription factor CREB, and together they bind cAMP response elements within the viral promoter and mediate high-level viral transcription. Signal-dependent CREB phosphorylation at Ser133 (pCREB) correlates with the activation of transcription. This activation has been attributed to recruitment of the coactivators CBP/p300 via physical interaction with the KIX domain. Here we show that the promoter-bound Tax/pCREB complex strongly recruits the recombinant, purified full-length coactivators CBP and p300. Additionally, the promoter-bound Tax/pCREB (but not Tax/CREB) complex recruits native p300 and potently activates transcription from chromatin templates. Unexpectedly, pCREB alone failed to detectably recruit the full-length coactivators, despite strong binding to KIX. These observations are in marked contrast to those in published studies that have characterized the physical interaction between KIX and pCREB and extrapolated these results to the full-length proteins. Consistent with our observation that pCREB is deficient for binding of CBP/p300, pCREB alone failed to support transcriptional activation. These data reveal that phosphorylation of CREB is not sufficient for CBP/p300 recruitment and transcriptional activation. The regulation of transcription by pCREB is therefore more complex than is generally recognized, and coregulators, such as Tax, likely play a critical role in the modulation of pCREB function.


arrow
INTRODUCTION
 
cAMP-response element binding protein (CREB) is one of the most widely studied transcription factors in metazoans. The basic leucine zipper region of CREB binds to cAMP response elements (CREs) and potentially regulates the expression of a significant percentage of genes in the human genome (13, 21, 53). The large number of cellular genes regulated by CREB exemplifies the critical role this archetypal transcription factor plays in vital cellular processes, such as development, differentiation, and cellular homeostasis. More than 300 distinct extracellular stimuli converge on several kinases, including protein kinases A and C, that phosphorylate CREB at serine 133 (Ser133) to activate the transcription function of CREB (22). Phosphorylated CREB (pCREB) then recruits the cellular coactivator paralogues CREB-binding protein (CBP) and p300 to activate transcription (8, 29, 36, 38).

A significant number of studies support a model of CREB transcription function whereby the binding of pCREB to the KIX domain of CBP/p300 is concomitant with coactivator recruitment and transcriptional activation. This model is largely based on characterization of the physical interaction between pCREB and the isolated KIX domain (38, 39) and subsequent extrapolation of these data to the recruitment of the full-length proteins. Emerging evidence, however, indicates that CREB phosphorylation may not be sufficient for CBP/p300 recruitment and transcription function. First, stimuli that lead to Ser133 phosphorylation of CREB induce transcription of only a subset of the many CRE-containing genes in vivo (5, 7, 41, 50, 51, 53). Recent genomewide analysis revealed that exposure of cells to the cAMP agonist forskolin resulted in phosphorylation of promoter-bound CREB but failed to induce transcription at the majority of CREB target genes identified (21, 51, 53). Consistent with these observations, a number of genes have been identified where phosphorylated CREB is bound at the promoter, yet CBP/p300 occupancy was not detected (41, 51, 53). Despite the evidence that CREB phosphorylation is insufficient for coactivator recruitment and gene activation at a large number of genes in vivo, pCREB recruitment of CBP/p300 remains the paradigm for signal-induced transcriptional activation in metazoans.

The expression of human T-cell leukemia virus type 1 (HTLV-1) is inextricably linked with CREB. HTLV-1 transcription is regulated primarily through three conserved CRE-containing enhancer elements, called viral CREs (vCREs), located in the viral promoter. The vCREs are composed of an off-consensus CRE core flanked by a short run of GC-rich DNA. CREB binds the CRE, and the virally encoded oncoprotein Tax binds adjacent to CREB in the minor groove of the GC-rich DNA (25, 32, 33, 37). Tax and CREB also directly interact (47), and together the proteins recruit CBP/p300 (17, 28) and coordinate the assembly of the transcriptional apparatus at the HTLV-1 promoter, resulting in high-level viral transcription. In vivo, at a chromosomally integrated HTLV-1 promoter, Tax recruits both CREB and p300 and activates transcription several hundredfold (31). These data are consistent with a longstanding model that Tax bypasses the requirement for CREB phosphorylation to recruit the coactivators and activate HTLV-1 transcription (17, 28). In contrast to this model, however, we recently found that the phosphorylated form of CREB is critical to stable complex formation with Tax, the KIX domain of CBP, and vCRE DNA (24). Furthermore, Tax was shown to induce CREB phosphorylation in vivo, suggesting that Tax and Ser133-phosphorylated CREB cooperate to promote the strong HTLV-1 transcriptional response (24, 48, 49).

In light of these observations, we set out to biochemically characterize the detailed molecular interactions between Tax, CREB, and full-length CBP/p300. Unexpectedly, we found that CRE-bound Ser133-phosphorylated CREB is insufficient to recruit full-length p300 or CBP. Tax in complex with pCREB, however, serves as a high-affinity binding site for the coactivators. We also found that HTLV-1 promoter-bound pCREB is deficient for transcription from chromatin templates in vitro, consistent with its inability to bind the coactivators. Furthermore, forskolin failed to stimulate vCRE-dependent transcription in vivo. Tax promoted strong transcriptional activation that was dependent upon pCREB and concomitant with p300 recruitment. These data provide the first direct evidence that CRE-bound pCREB is unable to effectively bind full-length CBP/p300 and provide a molecular explanation for the in vivo observations described above that noted an absence of CBP/p300 occupancy at a large number of genes bound by phosphorylated CREB. The data presented herein support an emerging body of evidence that pCREB requires additional regulatory molecules, functionally analogous to Tax, to modulate precise patterns of cellular gene expression.


arrow
MATERIALS AND METHODS
 
Nuclear extract. CEM cells, an HTLV-1-negative human T-cell line, were cultured in Iscove's modified Dulbecco's medium supplemented with fetal bovine serum. Nuclear extracts were prepared as previously described (11).

Expression and purification of recombinant proteins. Bacterially expressed Tax-His6, Ser133->A CREB (54), and glutathione S-transferase (GST)-KIX (CBP amino acids 588 to 683) (17) proteins were purified to >98% homogeneity as previously described (17). The KIX domain of CBP used in this study is 85% identical to the p300 KIX domain. CREB327 was purified to apparent homogeneity and was free of contaminating nucleic acids, as recently described (35). CREB327 is a naturally occurring splice variant where serine 119 corresponds to serine 133 in human CREB341 (2). To avoid confusion, we used the serine 133 nomenclature throughout this work. Both CREB327 and CREB341 gave identical results in the CBP/p300 recruitment (data not shown). Full-length His6-tagged p300 and Flag-tagged CBP were expressed from recombinant baculovirus in Sf9 cells and purified as previously described (27). All proteins were dialyzed against TM buffer (50 mM Tris [pH 7.9], 100 mM KCl, 12.5 mM MgCl2, 20% [vol/vol] glycerol, 0.025% vol/vol Tween 20, and 1 mM dithiothreitol), aliquoted, and stored at –70°C. CREB was phosphorylated using the catalytic subunit of protein kinase A by incubating 1.6 µM CREB in a reaction mixture containing 3.3 µM ATP, 5 mM MgCl2, and 55 U of protein kinase A (Sigma) in a 25 mM potassium phosphate buffer, pH 6.6.

Promoter fragments and oligonucleotides. A 643-bp promoter fragment was amplified by PCR from the 4TxRE/G-less plasmid template, which carries four reiterated copies of the HTLV-1 promoter-proximal vCRE cloned upstream of the HTLV-1 core promoter (1). Primers were designed to amplify the sequence between –187 and +456 and generate a fragment carrying a biotin group at the upstream end of the promoter. The native HTLV-1 promoter fragment, carrying sequences upstream of –306, was similarly prepared from the plasmid pHTLV-1/G-less. Primers for PCR amplification of 4TxRE/G-less were as follows: top strand, 5'-Bio/CATCGATAAGCTTCTAG; bottom strand, 5'-CATGATTACGCCAGGC. Primers for pHTLV-1/G-less were as follows: top strand, 5'-Bio/TGCCTGCAGGTCGAC; bottom strand, 5'-GCCTCAGGTAGGGCGGCGGG. The top strand, 5'-biotinylated sequences of the complementary oligonucleotides were as follows (CRE sequences underlined): Viral CRE, 5'-Bio/TTGTCAAGCCGTCCTCAGGCGTTGACGACAACCCCTCACCTCAAA; viral CRE with consensus octanucleotide core, 5'-Bio/TTGTCAAGCCGTCCTCAGGCGTTGACGTCAACCCCTCACCTCAAA; cellular CRE (somatostatin promoter), 5'-Bio/ATCAGGCTTCCTCCTCCTAGCCTGACGTCAGAGAGAGAGGTCGCC. The promoter fragments and the biotinylated double-stranded oligonucleotides were coupled to streptavidin Dynabeads (catalog no. 112.06; Dynal Biotech) at 0.08 pmol of DNA/µl of beads and 0.4 pmol of DNA/µl of beads, respectively. Binding was performed according to the manufacturer's instructions.

Antibodies. The following antibodies were used in Western blots: anti-CREB (sc-186), anti-phospho-Ser133 CREB (sc-7978-R), anti-p300 (sc-584), anti-CBP (sc-583), and anti-GST (sc-138). All were purchased from Santa Cruz Biotechnology. Alexa Fluor IR700 and IR800 goat antimouse and goat antirabbit secondary antibodies were purchased from Molecular Probes. A monoclonal Tax antibody (Hybridoma 168B17-46-92) was obtained from the National Institutes of Health Aids Research and Reference Reagent Program.

Immobilized template assay using purified proteins. Tax, CREB, or pCREB (8 pmol each) was added to 20 µl reactions containing TM buffer with 10% glycerol, 10 µM ZnSO4, 50 µM ATP, 80 µM acetyl-coenzyme A (CoA), 40 ng/µl of poly(dA-dT)-poly(dA-dT), and Dynabead-bound DNA (1 pmol for PCR fragments and 2 pmol for double-stranded oligonucleotides). Binding reactions were preincubated for 15 min at 30°C. Recombinant p300, CBP, or GST-KIX (2 pmol each) were then added to each sample in a final volume of 40 µl. Samples were mixed at 4°C for 1 h. Beads were magnetically isolated, washed three times with TM buffer, resuspended in 40 µl of Laemmli sample buffer (LSB), and boiled 5 min immediately prior to protein fractionation by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE).

Coupled immobilized template assay and in vitro transcription. Following chromatin assembly, preinitiation complexes were formed on 1 pmol of the bead-bound promoter fragment in the absence or presence of Tax (2.5 or 10 pmol) and/or CREB (2.5 pmol) in a 50-µl reaction volume. The transcription factors were incubated with TM buffer, 50 µM ATP, and 50 µM acetyl-CoA for 15 min at 30°C. CEM nuclear extract (100 µg) was added to each binding reaction and incubated for an additional 60 min at 4°C. To analyze bound proteins, 46 µl of the total binding reaction mixture was removed, washed three times with TM buffer, resuspended in LSB, and analyzed by SDS-PAGE and Western blotting. The remaining 4 µl was processed for transcription analysis. The reaction mixture was brought to 30 µl with TM buffer and 50 µM acetyl-CoA, and RNA synthesis was initiated with the addition of 250 µM ATP, 250 µM CTP, 12 µM UTP, and 0.8 µM [{alpha}-32P]UTP (3,000 Ci/mmol). Transcription reactions were processed and analyzed as previously described (32). Molecular weight markers (radiolabeled HpaII-digested pBR322) were used to estimate the sizes of the RNA products. A labeled 622-bp DNA fragment was added to each reaction mixture as a recovery standard.

Chromatin assembly. Recombinant Drosophila histones were assembled into chromatin as previously described (14, 16, 26), except that the assembly was performed on the linear, bead-bound promoter fragments. Assembly was performed at a 4:7 histone:DNA mass ratio. The degree of assembly was confirmed by micrococcal nuclease digestion (26). Micrococcal nuclease digestion of the chromatin-assembled 4TxRE promoter template is shown by Sharma et al. (44).

Protein analysis by SDS-PAGE. Proteins were resolved by SDS-polyacrylamide linear gradient gels and either silver stained or transferred to nitrocellulose and probed with the indicated antibodies. For the chromatin-based binding reactions, two-thirds of each sample was also resolved on an 18% polyacrylamide gel and histone proteins were visualized by Coomassie brilliant blue staining.

Transient-transfection assays. Human Jurkat T cells were cultured in Iscove's modified Dulbecco's medium supplemented with 10% fetal calf serum, 2 mM L-glutamine, and penicillin-streptomycin. Cells were serum starved (0.5% fetal bovine serum) and transfected with a constant amount of DNA using the Lipofectamine reagent (Invitrogen). After 24 h, the cells were harvested and lysed and luciferase activity was measured using the dual-luciferase reporter assay system (Promega) with a Turner Designs model TD 20-e luminometer. Firefly luciferase activity was normalized to Renilla luciferase activity from the herpes simplex virus thymidine kinase promoter (pRL-TK; Promega). The expression plasmid for Tax (pSG-Tax) (42) and the vCRE-Luc reporter plasmid (17) have been previously described. The transient-transfection assay was performed in triplicate and repeated in three independent experiments.

Image processing. The ImageQuant program (Molecular Dynamics) was used to quantify results. Images were processed in Adobe Photoshop, with minor adjustments to brightness/contrast as needed (gamma was kept at 1). No bands were obscured or altered. Images were annotated in PowerPoint. All experiments presented here were shown to be reproducible in at least three independent trials.


arrow
RESULTS
 
Tax requires pCREB for efficient recruitment of full-length p300 and CBP. Our initial goal was to study the coactivator recruitment characteristics of HTLV-1 promoter-bound Tax in complex with unphosphorylated and Ser133-phosphorylated CREB. Nearly all previously published studies characterized the physical interaction of the Tax/CREB/vCRE complex with the KIX domain of CBP/p300. To investigate the recruitment of full-length p300 in vitro, we performed DNA pull-down assays using a promoter fragment carrying four tandem copies of the highly Tax-responsive vCREs (p4TxRE/G-less [1]). A biotin group was incorporated at the upstream end of the DNA, and the fragment was immobilized on magnetic streptavidin-agarose beads. Highly purified, recombinant proteins (Fig. 1A) were incubated with the biotinylated DNA template and washed, and the bound proteins were analyzed by Western blotting. In these studies, we optimized the concentrations of purified Tax and CREB or protein kinase A-phosphorylated CREB to saturate binding at the vCREs. We then added purified p300 at a physiologically relevant concentration (50 nM) (20).


Figure 1
View larger version (42K):
[in this window]
[in a new window]

 
FIG. 1. Recruitment of p300 and CBP to a viral CRE-containing promoter requires pCREB and Tax. (A) Analysis of recombinant, purified proteins by SDS-PAGE and silver staining. Molecular weight markers are indicated. (B) Immobilized 4TxRE promoter DNA (1 pmol) was incubated with full-length p300 (2 pmol) in the presence of CREB, CREB plus Tax, pCREB, and pCREB plus Tax (8 pmol each) as indicated. Bound complexes were washed, and DNA-bound proteins were separated on a 6%-to-12%-gradient SDS-polyacrylamide gel and analyzed by Western blotting. (C) Densitometric analysis of p300 binding from three independent experiments is presented graphically. (D) Analysis of recombinant, full-length CBP recruitment to the immobilized 4TxRE template in the presence of CREB, CREB plus Tax, pCREB, and pCREB plus Tax (8 pmol each), as indicated. The experiment was performed exactly as described for panel B, except purified, recombinant full-length CBP (2 pmol) was used in the binding reaction in place of p300.

We observed dramatically enhanced recruitment of full-length p300 to the Tax/pCREB complex relative to the Tax/CREB complex (Fig. 1B, lanes 1 and 3), indicating that Tax does not bypass the need for CREB phosphorylation in the recruitment of p300. These data are consistent with those of recent studies from our laboratory showing that pCREB stabilizes the complex containing Tax, KIX, and the vCRE much more effectively than the unphosphorylated form of the protein (24). Furthermore, recent studies indicate that Tax is directly responsible for promoting elevated levels of CREB phosphorylation in vivo (24, 48, 49). Together, these data indicate that phosphorylated CREB may play a prominent role in Tax transactivation.

Unexpectedly, the binding of full-length p300 to the HTLV-1 promoter in the presence of pCREB was nearly undetectable (Fig. 1B, lane 2). The addition of Tax produced a significant increase in p300 binding (compare lanes 1 and 3). This is in contrast to studies that used the isolated KIX domain of CBP/p300 to conclude that pCREB strongly recruits the full-length coactivators. DNA pull-down data from three independent experiments was quantified, and a graph showing the relative recruitment of p300 by the various DNA-bound complexes is shown in Fig. 1C. Compared with results for unphosphorylated CREB, pCREB enhanced p300 binding sixfold. The Tax/CREB complex enhanced p300 binding 40-fold relative to results for CREB. The Tax/pCREB complex further enhanced p300 binding 90-fold relative to results for pCREB. These binding assays were performed under a variety of conditions, including the absence and presence of acetyl-CoA and ATP. A recent study found that in the presence of acetyl-CoA, p300 was released from promoter templates following autoacetylation (3). We found that p300 recruitment was unaffected by acetyl-CoA and ATP in our assays (data not shown).

The dramatic results obtained with full-length p300 prompted us to perform the parallel experiment with the full-length paralogue CBP. Both coactivators have been implicated in Tax transactivation and signal-dependent transcription by CREB. The experiment presented in Fig. 1D revealed that Tax and pCREB are both required for CBP recruitment to the Tax-responsive promoter fragment and again that pCREB alone is insufficient for recruitment of the eponymous coactivator. As a control, we tested both CBP and p300 histone acetyltransferase activities and found that the two proteins were similarly active, indicating that they were functionally competent in our assays (data not shown). These data show that recombinant full-length CBP and p300 require both Tax and pCREB to bind the vCRE-containing promoter template in our recruitment assays.

CRE-bound pCREB recruits the isolated KIX domain but not full-length p300. In the experiments presented in Fig. 1, we used a promoter fragment carrying four copies of the Tax-responsive vCRE cloned upstream of a minimal promoter. Because of the significance of the data obtained with this fragment, we were interested in determining whether Tax and pCREB similarly supported the recruitment of p300 to the natural HTLV-1 promoter fragment (pLTR-G-less) (1). Figure 2A shows that p300 recruitment achieved with the natural HTLV-1 promoter was essentially identical to that with the synthetic promoter (see Fig. 1B). As expected, we did not observe Tax binding or p300 recruitment in the absence of CREB (Fig. 2A, lane 3).


Figure 2
View larger version (45K):
[in this window]
[in a new window]

 
FIG. 2. Individual viral and cellular CRE sequences support Tax/pCREB recruitment of p300. (A) The immobilized template assay was performed with the natural HTLV-1 promoter. Binding reactions and analyses were performed as described for Fig. 1B. (B) Partial top-strand sequence of the double-stranded oligonucleotides used in the immobilized template assays shown in panels C and D (see Materials and Methods for the complete sequences). The conserved Tax-binding sequences are indicated with a dashed underline. Nucleotides conforming to the consensus CRE are underlined. (C) The immobilized template assay was performed with the individual 45-bp doubled-stranded CRE sequences shown in panel B. Binding reactions and analyses were performed as described for Fig. 1B. The upper panel is a darker and higher-contrast version of the same p300 blot shown directly below and shows weak detection of p300 in lanes 1 and 2. (D) Immobilized template assay performed in parallel with the experiment shown in panel C, except that GST-KIX was included in the binding reactions in place of p300.

We next analyzed the recruitment of p300 to complexes formed on immobilized double-stranded oligonucleotide templates carrying various individual binding sites. We were interested in comparing pCREB and Tax/pCREB recruitment of p300 to an off-consensus CRE versus a consensus CRE. CREB binds the consensus CRE with an approximately 10-fold greater affinity than that for the off-consensus CREs present in the viral promoter (4). In parallel binding assays, we compared recruitment of p300 by Tax and pCREB to the single, promoter-proximal viral CRE and a consensus cellular CRE, which does not carry the GC-rich sequences necessary for Tax binding (Fig. 2B). Each oligonucleotide was designed with the core CRE sequence starting 23 bp from the upstream biotinylated end. As expected, Tax was not recruited to the cellular CRE (Fig. 2C, lanes 1 and 3). However, we reasoned that since this oligonucleotide contains the optimal CREB binding site, it may allow pCREB alone to recruit p300. Instead, recruitment of p300 by pCREB to the consensus CRE was nearly undetectable (Fig. 2C, lanes 1 to 4). We also designed a binding site carrying a consensus CRE and the GC-rich flanking sequences necessary for Tax recruitment (Fig. 2B). Inclusion of the GC-rich sequences adjacent to the consensus CRE recovered Tax binding and restored p300 recruitment by the Tax/pCREB complex (Fig. 2C, lanes 5 to 8). Together, these data reveal a strict requirement for Tax in complex with pCREB in the recruitment of p300 to the viral promoter.

Our inability to detect pCREB recruitment of the coactivators is significant. Therefore, we wanted to confirm that the full-length coactivators possessed regulatory properties lost in the isolated KIX domain. We next directly analyzed the binding of the various DNA-bound complexes to the KIX domain of CBP. The experiment shown in Fig. 2D was performed in parallel with the experiment shown in Fig. 2C, enabling direct comparison of KIX and p300 recruitment. Importantly, in the absence of Tax, we observed distinct patterns of KIX and p300 recruitment by pCREB (Fig. 2D). Paradoxically, pCREB strongly recruited KIX, despite being defective for p300 recruitment (compare Fig. 2C and D, lanes 1 and 2). As previously observed (17, 28), Tax in complex with unphosphorylated CREB also bound KIX (Fig. 2D, lanes 7 and 11), in contrast to our observations with full-length p300. Together, these data indicate that results of recruitment studies with the KIX domain may not represent the physiological interaction and that strong recruitment of the full-length coactivators requires additional regulators, such as Tax.

Tax/pCREB recruitment of p300 to the viral promoter correlates with strong transcriptional activation. Because of the relevance of our data to Tax and pCREB regulatory function, we tested the recruitment of native p300 to physiologically relevant chromatin templates. For these studies, we assembled the Tax-responsive promoter fragment used in Fig. 1 into chromatin, using purified Drosophila core histones and the recombinant assembly proteins Acf1/ISWI and Drosophila NAP-1 (14, 26, 34). Micrococcal nuclease assays were performed to verify the assembly of nucleosomes on the immobilized promoter fragment. The chromatin template was preincubated with pCREB alone or pCREB in the presence of increasing concentrations of Tax, followed by incubation with T-cell nuclear extract (HTLV-1-negative CEM cells). The immobilized template was washed, and bound proteins were subjected to SDS-PAGE and visualized by Western blotting. To assess the binding of nucleosomes to the washed templates, histones were visualized by Coomassie brilliant blue staining (Fig. 3A, lower panel). Tax in complex with pCREB but not pCREB alone was required for efficient recruitment of endogenous p300 to the promoter template (Fig. 3A, upper panel). We next assayed a portion of each binding reaction shown in Fig. 3A by in vitro transcription. As expected, transcription from the 4TxRE/G-less template was fully repressed in the presence of chromatin (Fig. 3B, lanes 1 and 2) (15, 16). The addition of pCREB had no detectable effect on transcriptional output, despite the strong binding to the template shown in Fig. 3A (lane 2). The absence of a transcription signal with pCREB correlated directly with the weak recruitment of p300 observed in the immobilized template assay. The addition of Tax and pCREB together, however, resulted in potent activation of transcription. We were also interested in testing whether Tax and unphosphorylated CREB could activate vCRE-dependent transcription. However, CREB becomes phosphorylated in the presence of ATP, which is required for the in vitro transcription reaction (data not shown). We therefore analyzed the CREB Ser133-to-Ala mutant (Ser133->A CREB), which cannot be phosphorylated. Tax and Ser133->A CREB were unable to activate transcription, confirming that Tax and pCREB are both necessary for viral transcription (Fig. 3C). We next assayed p300 recruitment together with Tax-pCREB-dependent transcription in the presence of increasing concentrations of GST-KIX. We have previously shown that binding of KIX to the Tax/pCREB/vCRE complex blocks recruitment of full-length p300 (15). GST-KIX (but not GST) simultaneously blocked p300 recruitment and potently inhibited Tax/pCREB-mediated transcription (Fig. 3D). These data directly correlate p300 recruitment with Tax-dependent transactivation.


Figure 3
View larger version (57K):
[in this window]
[in a new window]

 
FIG. 3. Recruitment of endogenous p300 correlates with transcriptional activation from chromatin templates. (A) Immobilized, chromatin-assembled 4TxRE promoter DNA (1 pmol) was incubated in the absence (lane 1) or presence of pCREB (2.5 pmol) (lane 2) and increasing amounts of Tax (2.5 or 10 pmol) (lane 3 and 4), as indicated. Following the preincubation step, CEM nuclear extract was added and samples were incubated for 60 min at 4°C. Immobilized complexes were washed and analyzed by using a 4-to-20% SDS-polyacrylamide gradient gel and Western blotting (upper three panels). A portion of each binding reaction was resolved on an 18% SDS-polyacrylamide gel and stained with Coomassie to detect bound histone proteins (lower panel). Western blot of p300 present in the nuclear extract input (50%) and a Coomassie-stained gel of input histone (100%) are shown. (B) Small aliquots from each binding reaction mixture above (8% of the total) were incubated with acetyl-CoA and nucleoside triphosphates and analyzed in duplicate by in vitro transcription. The positions of molecular weight size markers, recovery standard, and full-length G-less transcripts are indicated. (C) Transcription reactions were performed with the unphosphorylatable mutant Ser133->A CREB (CREBS133A) and compared with results for pCREB. (All samples were analyzed on a single gel, but lanes 7 and 8 and lanes 9 and 10 were rearranged for this figure to maintain consistency with other experiments.) (D) Protein binding and transcription reactions were performed as described for panels A and B but in the presence of increasing amounts of purified GST-KIX (2.5, 5, and 25 pmol) (lanes 4 to 6), as indicated. GST alone (25 pmol) was used as a negative control (lane 7). Results from the transcription assay are shown in the top panel, and Western blots of bound p300, Tax, GST-KIX, and pCREB are shown in the lower three panels. Input Tax, pCREB, GST-KIX (2.5 pmol purified protein), and p300 (50% of nuclear extract) are shown in lane 8. (E) HTLV-1-negative Jurkat T cells were serum starved (0.5% FBS) and then cotransfected with the vCRE-luc reporter plasmid (100 ng) (17) and a Tax expression plasmid (pSG-Tax, 100 ng) (42). Eight hours prior to harvest, cells were treated with forskolin (FSK) (10 µM) or the dimethylsulfoxide vector and then analyzed by luciferase assay. Transient transfections were performed in triplicate, and each experiment was repeated three times. Relative luciferase activity is shown on the y axis. Corresponding Western blots probed against pCREB and Tax are shown for the samples analyzed in the luciferase assay.

The inability of pCREB to produce a transcriptional response from the vCRE promoter in vitro prompted us to explore the effect of CREB phosphorylation at a comparable promoter in vivo. We performed transient cotransfection assays using a Tax expression plasmid and a luciferase reporter plasmid. The vCRE-luciferase reporter plasmid carried three tandem copies of the vCRE immediately upstream of a core promoter (17). We used this Tax-responsive reporter construct to examine the effect of CREB phosphorylation mediated through the vCREs, without the influence of other promoter elements. Transfection assays were performed in HTLV-1-negative Jurkat T cells in the absence or presence of forskolin, a cAMP agonist that induces Ser133 CREB phosphorylation. Figure 3E shows that forskolin treatment had no effect on vCRE-dependent transcription in the absence of Tax, consistent with the in vitro transcription assays performed with pCREB. Forskolin also had no effect on Tax transactivation, since Tax expression is sufficient to induce CREB phosphorylation in vivo (Fig. 3E, lane 3) (24, 48, 49). Similar results were obtained using the natural HTLV-1 promoter (data now shown). We confirmed that forskolin was active, since treatment with the agonist increased the levels of intracellular CREB phosphorylation (Fig. 3E) (24). These data are consistent with findings of chromatin immunoprecipitation studies that demonstrated the in vivo recruitment of p300 by CREB and Tax (31). These data provide further supporting evidence indicating that CREB phosphorylation alone is insufficient for transcriptional activation.


arrow
DISCUSSION
 
Since the early 1990s, the physical interaction between Ser133-phosphorylated CREB and the KIX domain of CBP/p300 has been viewed as the sole obligate event for the recruitment of the coactivators and the activation of signal-dependent target genes. The original benchmark in vitro observations have been corroborated in a number of biochemical and structural studies using the KIX domain (8, 29, 36, 38, 39). This view, however, is beginning to change, as a number of recent studies have found that signal-induced CREB phosphorylation does not lead to CBP/p300 recruitment at the majority of CREB target promoters in vivo (41, 51, 53). These data suggest that additional mechanisms are required for efficient recruitment of CBP/p300 to phosphorylated CREB bound at promoters in vivo.

The HTLV-1 Tax oncoprotein functions together with CREB to potently activate transcription mediated through the three viral CREs present in the viral promoter. Previous studies demonstrated that Tax had little effect on the otherwise strong recruitment of KIX by pCREB (17, 28). Instead, Tax significantly enhanced the recruitment of KIX to unphosphorylated CREB (17, 28). This led to the hypothesis that Tax bypasses the requirement for CREB phosphorylation in CBP/p300 recruitment to the viral promoter. However, several recent studies show that Tax stimulates CREB phosphorylation in vivo (24, 48, 49). This observation is consonant with the fact that Tax robustly activates HTLV-1 transcription independently of inducers of CREB phosphorylation. Together, these data indicate that Tax functions in concert with pCREB to activate HTLV-1 transcription. However, the precise role of pCREB in Tax function remains enigmatic.

In this study, we initiated an investigation to better elucidate the interplay between Tax and pCREB in CBP/p300 recruitment and Tax transactivation. Since Tax has been shown to bind the coactivators at multiple sites (17, 19, 30, 43, 52), we analyzed Tax/pCREB recruitment of full-length p300 to immobilized CRE-containing DNA templates. Unexpectedly, we found that promoter-bound pCREB alone only very weakly recruited full-length p300 or its paralogue, CBP. Tax in complex with phosphorylated CREB, however, strongly recruited both full-length coactivators. Tax in complex with unphosphorylated CREB only weakly recruited the coactivators. Because these results diverge significantly from existing models of pCREB and Tax/CREB recruitment of CBP/p300, we directly compared recruitment of full-length p300 and the isolated KIX domain. We found that CRE-bound pCREB alone strongly recruited KIX, despite only very weak recruitment of full-length p300. The failure of pCREB to recruit full-length p300 was highly reproducible on various CRE sequences, including the consensus CRE derived from the somatostatin promoter, and on both naked and chromatin-assembled promoter templates. Consistent with our in vitro observations, stimulus-induced CREB phosphorylation had no effect on vCRE-dependent transcription in vivo. Finally, we observed a direct correlation between recruitment of native p300 to chromatin-bound Tax/pCREB complexes and transcriptional activation in vitro. Based on these findings, we conclude that CRE-bound pCREB is not sufficient for CBP/p300 recruitment and transcriptional activation and that additional regulators, such as Tax, serve to facilitate pCREB recruitment of the coactivators and subsequent transcriptional activation.

The conserved KIX domain of CBP/p300 is composed of three {alpha}-helices that form a compact hydrophobic core with two discrete transcription factor binding surfaces (18, 39). These binding sites reside on opposite faces of KIX, and each has been shown to bind several unrelated transcription factors (6, 10, 12, 18, 39, 55, 56). We recently demonstrated that full-length pCREB and Tax interact simultaneously at each of the two distinct binding sites on KIX, forming a very stable quaternary complex with the vCRE DNA (40). The simultaneous contacts made by Tax and pCREB within KIX likely occur as a consequence of their close proximity when bound to the vCRE, as well as intimate protein-protein interactions between the two activators (Fig. 4). This observation may provide insight into the mechanism by which Tax and pCREB cooperate to recruit CBP/p300. We hypothesize that the pCREB binding site on KIX is inaccessible in the context of the full-length coactivator. Binding of Tax on one surface of KIX induces a conformational change that exposes the high-affinity pCREB binding site. Since this site is obscured in the context of the full-length coactivators, other regions of CBP/p300 must regulate the accessibility or conformation of the hydrophobic groove where pCREB binds (Fig. 4).


Figure 4
View larger version (46K):
[in this window]
[in a new window]

 
FIG. 4. Model comparing the recruitment of full-length CBP/p300 and the KIX domain by CRE-bound Tax and pCREB. (A) Full-length CBP/p300 recruitment by the DNA-bound Tax/pCREB complex. The model depicts initial KIX contact by Tax, promoting a conformational change that enables pCREB binding and stable coactivator recruitment. (B) The model depicts distinct mechanisms of KIX recruitment by pCREB and the Tax/CREB complex. Tax recruits KIX in the presence of unphosphorylated CREB (left). The pCREB binding site on KIX is accessible, allowing recruitment in the absence of Tax (right).

Our observation that Tax is required for recruitment of full-length CBP/p300 by pCREB suggests a role for cellular factors that are functionally analogous to Tax. For example, cellular KIX-interacting transcription factors may also bind immediately adjacent to pCREB, exposing the pCREB interaction site. MLL and c-Jun each bind KIX at the same site as Tax, which is distinct from the pCREB binding site (6, 10, 18, 55). Recently Goto et al. showed that binding of the MLL activation domain to KIX enhanced binding of the phosphorylated KID region of CREB, providing direct evidence for cooperative binding of transcription factors within the KIX domain (18). These data provide additional support for the hypothesis that additional KIX-binding transcription factors likely participate in phosphorylation-dependent recruitment of full-length CBP/p300 by CREB in vivo.

There are more than 200 transcription factors that interact at multiple domains within CBP/p300 (23). It is possible that one or more of these transcription factors bound at distal cis-acting elements within CREB target gene promoters may induce a conformational change elsewhere in full-length CBP/p300 that is transmitted into KIX, facilitating stable binding of pCREB. Alternatively, the presence of multiple trans-acting factors at target promoters, each with a relatively low affinity for CBP/p300, may together increase the local concentration of the coactivators sufficiently to enable pCREB binding. This idea is supported by the fact that we observe weak phosphorylation-dependent CREB binding to p300 at very high concentrations of the coactivator (0.4 µM; data not shown). Since CBP and p300 appear to be limiting in cells (45), the unique combinations of transcription factors, with various affinities for the coactivators, may promote distinct programs of transcriptional response to signal-dependent phosphorylation of CREB.

Finally, the members of the family of proteins called transducers of regulated CREB (TORCs) have been recognized as important cofactors in phosphorylated CREB-mediated transcriptional activation in vivo (46). Two recent studies explored transcriptional activation by phosphorylated CREB and found that TORC2 was required for CBP/p300 recruitment and activation of selective genes in vivo (41, 51). Reduction of TORC2 activity produced a decline in the occupancy of promoter-bound CBP/p300 and diminished transcription in response to CREB phosphorylation (41, 51). Notably, the TORC proteins facilitated coactivator recruitment by pCREB via interactions with both CBP/p300 and the bZIP domain of DNA-bound CREB (9, 41, 51). Therefore, the mechanism of TORC coactivator recruitment to pCREB is likely functionally analogous to Tax.

In summary, we found that pCREB alone is not sufficient for recruitment of full-length CBP/p300. Instead, other cofactors, like Tax, are obligate regulators in pCREB recruitment of the coactivators. The data presented herein provide compelling evidence for a conformational change in full-length CBP/p300 upon Tax binding that uncovers the pCREB binding site in KIX. However, the precise molecular mechanism that facilitates phosphorylation-dependent binding of CREB to the full-length coactivators remains elusive. By characterizing the mechanisms underlying Tax-mediated corecruitment of CBP/p300 and by identifying and characterizing cellular proteins that stabilize the assembly of coactivator complexes with phosphorylated CREB, we may better understand how signal-dependent phosphorylation of CREB can lead to selective modulation of cellular gene expression.


arrow
ACKNOWLEDGMENTS
 
We thank Paul Laybourn and Julita Ramìrez for invaluable suggestions and discussion, Heather Szerlong and Mara Miller for critical reading of the manuscript, and Dinaida Lopez and Jeanne Mick for purified Tax and pCREB.

This work was supported by a grant from the National Institutes of Health (CA55035).


arrow
FOOTNOTES
 
* Corresponding author. Mailing address: Department of Biochemistry and Molecular Biology, Campus Box 1870, Colorado State University, Fort Collins, CO 80523-1870. Phone: (970) 491-0420. Fax: (970) 491-0494. E-mail: jennifer.nyborg{at}colostate.edu Back

{triangledown} Published ahead of print on 10 December 2007. Back


arrow
REFERENCES
 
    1
  1. Anderson, M. G., K. E. Scoggin, C. M. Simbulan-Rosenthal, and J. A. Steadman. 2000. Identification of poly(ADP-ribose) polymerase as a transcriptional coactivator of the human T-cell leukemia virus type 1 Tax protein. J. Virol. 74:2169-2177.[Abstract/Free Full Text]
  2. 2
  3. Berkowitz, L. A., and M. Z. Gilman. 1990. Two distinct forms of active transcription factor CREB (cAMP response element binding protein). Proc. Natl. Acad. Sci. USA 87:5258-5262.[Abstract/Free Full Text]
  4. 3
  5. Black, J. C., J. E. Choi, S. R. Lombardo, and M. Carey. 2006. A mechanism for coordinating chromatin modification and preinitiation complex assembly. Mol. Cell 23:809-818.[CrossRef][Medline]
  6. 4
  7. Brauweiler, A., P. Garl, A. A. Franklin, H. A. Giebler, and J. K. Nyborg. 1995. A molecular mechanism for human T-cell leukemia virus latency and Tax transactivation. J. Biol. Chem. 270:12814-12822.[Abstract/Free Full Text]
  8. 5
  9. Brindle, P., T. Nakajima, and M. Montminy. 1995. Multiple protein kinase A-regulated events are required for transcriptional induction by cAMP. Proc. Natl. Acad. Sci. USA 92:10521-10525.[Abstract/Free Full Text]
  10. 6
  11. Campbell, K. M., and K. J. Lumb. 2002. Structurally distinct modes of recognition of the KIX domain of CBP by Jun and CREB. Biochemistry 41:13956-13964.[CrossRef][Medline]
  12. 7
  13. Cha-Molstad, H., D. M. Keller, G. S. Yochum, S. Impey, and R. H. Goodman. 2004. Cell-type-specific binding of the transcription factor CREB to the cAMP-response element. Proc. Natl. Acad. Sci. USA 101:13572-13577.[Abstract/Free Full Text]
  14. 8
  15. Chrivia, J. C., R. P. Kwok, N. Lamb, M. Hagiwara, M. R. Montminy, and R. H. Goodman. 1993. Phosphorylated CREB binds specifically to the nuclear protein CBP. Nature 365:855-859.[CrossRef][Medline]
  16. 9
  17. Conkright, M. D., G. Canettieri, R. Screaton, E. Guzman, L. Miraglia, J. B. Hogenesch, and M. Montminy. 2003. TORCs: transducers of regulated CREB activity. Mol. Cell 12:413-423.[CrossRef][Medline]
  18. 10
  19. De Guzman, R. N., N. K. Goto, H. J. Dyson, and P. E. Wright. 2006. Structural basis for cooperative transcription factor binding to the CBP coactivator. J. Mol. Biol. 355:1005-1013.[CrossRef][Medline]
  20. 11
  21. Dynan, W. S. 1987. DNase I footprinting as an assay for mammalian gene regulatory proteins. Genet. Eng. 9:75-87.
  22. 12
  23. Ernst, P., J. Wang, M. Huang, R. H. Goodman, and S. J. Korsmeyer. 2001. MLL and CREB bind cooperatively to the nuclear coactivator CREB-binding protein. Mol. Cell. Biol. 21:2249-2258.[Abstract/Free Full Text]
  24. 13
  25. Euskirchen, G., T. E. Royce, P. Bertone, R. Martone, J. L. Rinn, F. K. Nelson, F. Sayward, N. M. Luscombe, P. Miller, M. Gerstein, S. Weissman, and M. Snyder. 2004. CREB binds to multiple loci on human chromosome 22. Mol. Cell. Biol. 24:3804-3814.[Abstract/Free Full Text]
  26. 14
  27. Fyodorov, D. V., and J. T. Kadonaga. 2003. Chromatin assembly in vitro with purified recombinant ACF and NAP-1. Methods Enzymol. 371:499-515.[Medline]
  28. 15
  29. Georges, S. A., H. A. Giebler, P. A. Cole, K. Luger, P. J. Laybourn, and J. K. Nyborg. 2003. Tax recruitment of CBP/p300, via the KIX domain, reveals a potent requirement for acetyltransferase activity that is chromatin dependent and histone tail independent. Mol. Cell. Biol. 23:3392-3404.[Abstract/Free Full Text]
  30. 16
  31. Georges, S. A., W. L. Kraus, K. Luger, J. K. Nyborg, and P. J. Laybourn. 2002. p300-mediated tax transactivation from recombinant chromatin: histone tail deletion mimics coactivator function. Mol. Cell. Biol. 22:127-137.[Abstract/Free Full Text]
  32. 17
  33. Giebler, H. A., J. E. Loring, K. van Orden, M. A. Colgin, J. E. Garrus, K. W. Escudero, A. Brauweiler, and J. K. Nyborg. 1997. Anchoring of CREB binding protein to the human T-cell leukemia virus type 1 promoter: a molecular mechanism of Tax transactivation. Mol. Cell. Biol. 17:5156-5164.[Abstract]
  34. 18
  35. Goto, N. K., T. Zor, M. Martinez-Yamout, H. J. Dyson, and P. E. Wright. 2002. Cooperativity in transcription factor binding to the coactivator CREB-binding protein (CBP). J. Biol. Chem. 277:43168-43174.[Abstract/Free Full Text]
  36. 19
  37. Harrod, R., Y. Tang, C. Nicot, H. S. Lu, A. Vassilev, Y. Nakatani, and C. Z. Giam. 1998. An exposed KID-like domain in human T-cell lymphotropic virus type 1 Tax is responsible for the recruitment of coactivators CBP/p300. Mol. Cell. Biol. 18:5052-5061.[Abstract/Free Full Text]
  38. 20
  39. Hottiger, M. O., L. K. Felzien, and G. J. Nabel. 1998. Modulation of cytokine-induced HIV gene expression by competitive binding of transcription factors to the coactivator p300. EMBO J. 17:3124-3134.[CrossRef][Medline]
  40. 21
  41. Impey, S., S. R. McCorkle, H. Cha-Molstad, J. M. Dwyer, G. S. Yochum, J. M. Boss, S. McWeeney, J. J. Dunn, G. Mandel, and R. H. Goodman. 2004. Defining the CREB regulon: a genome-wide analysis of transcription factor regulatory regions. Cell 119:1041-1054.[Medline]
  42. 22
  43. Johannessen, M., M. P. Delghandi, and U. Moens. 2004. What turns CREB on? Cell. Signal. 16:1211-1227.[CrossRef][Medline]
  44. 23
  45. Kasper, L. H., and P. K. Brindle. 2006. Mammalian gene expression program resiliency: the roles of multiple coactivator mechanisms in hypoxia-responsive transcription. Cell Cycle 5:142-146.[Medline]
  46. 24
  47. Kim, Y. M., J. A. Ramirez, J. E. Mick, H. A. Giebler, J. P. Yan, and J. K. Nyborg. 2007. Molecular characterization of the Tax-containing HTLV-1 enhancer complex reveals a prominent role for CREB phosphorylation in Tax transactivation. J. Biol. Chem. 282:18750-18757.[Abstract/Free Full Text]
  48. 25
  49. Kimzey, A. L., and W. S. Dynan. 1998. Specific regions of contact between human T-cell leukemia virus type I Tax protein and DNA identified by photocross-linking. J. Biol. Chem. 273:13768-13775.[Abstract/Free Full Text]
  50. 26
  51. Konesky, K. L., and P. J. Laybourn. 2007. Biochemical analyses of transcriptional regulatory mechanisms in a chromatin context. Methods 41:259-270.[CrossRef][Medline]
  52. 27
  53. Kraus, W. L., E. T. Manning, and J. T. Kadonaga. 1999. Biochemical analysis of distinct activation functions in p300 that enhance transcription initiation with chromatin templates. Mol. Cell. Biol. 19:8123-8135.[Abstract/Free Full Text]
  54. 28
  55. Kwok, R. P., M. E. Laurance, J. R. Lundblad, P. S. Goldman, H. Shih, L. M. Connor, S. J. Marriott, and R. H. Goodman. 1996. Control of cAMP-regulated enhancers by the viral transactivator Tax through CREB and the co-activator CBP. Nature 380:642-646.[CrossRef][Medline]
  56. 29
  57. Kwok, R. P., J. R. Lundblad, J. C. Chrivia, J. P. Richards, H. P. Bachinger, R. G. Brennan, S. G. Roberts, M. R. Green, and R. H. Goodman. 1994. Nuclear protein CBP is a coactivator for the transcription factor CREB. Nature 370:223-226.[CrossRef][Medline]
  58. 30
  59. Lemasson, I., and J. K. Nyborg. 2001. Human T-cell leukemia virus type I tax repression of p73beta is mediated through competition for the C/H1 domain of CBP. J. Biol. Chem. 276:15720-15727.[Abstract/Free Full Text]
  60. 31
  61. Lemasson, I., N. J. Polakowski, P. J. Laybourn, and J. K. Nyborg. 2006. Tax-dependent displacement of nucleosomes during transcriptional activation of human T-cell leukemia virus type 1. J. Biol. Chem. 281:13075-13082.[Abstract/Free Full Text]
  62. 32
  63. Lenzmeier, B. A., E. E. Baird, P. B. Dervan, and J. K. Nyborg. 1999. The tax protein-DNA interaction is essential for HTLV-I transactivation in vitro. J. Mol. Biol. 291:731-744.[CrossRef][Medline]
  64. 33
  65. Lenzmeier, B. A., H. A. Giebler, and J. K. Nyborg. 1998. Human T-cell leukemia virus type 1 Tax requires direct access to DNA for recruitment of CREB binding protein to the viral promoter. Mol. Cell. Biol. 18:721-731.[Abstract/Free Full Text]
  66. 34
  67. Livengood, J. A., K. E. Scoggin, K. Van Orden, S. J. McBryant, R. S. Edayathumangalam, P. J. Laybourn, and J. K. Nyborg. 2002. p53 transcriptional activity is mediated through the SRC1-interacting domain of CBP/p300. J. Biol. Chem. 277:9054-9061.[Abstract/Free Full Text]
  68. 35
  69. Lopez, D. I., J. E. Mick, and J. K. Nyborg. 2007. Purification of CREB to apparent homogeneity: removal of truncation products and contaminating nucleic acid. Protein Expr. Purif. 55:406-418.[CrossRef][Medline]
  70. 36
  71. Lundblad, J. R., R. P. Kwok, M. E. Laurance, M. L. Harter, and R. H. Goodman. 1995. Adenoviral E1A-associated protein p300 as a functional homologue of the transcriptional co-activator CBP. Nature 374:85-88.[CrossRef][Medline]
  72. 37
  73. Lundblad, J. R., R. P. Kwok, M. E. Laurance, M. S. Huang, J. P. Richards, R. G. Brennan, and R. H. Goodman. 1998. The human T-cell leukemia virus-1 transcriptional activator Tax enhances cAMP-responsive element-binding protein (CREB) binding activity through interactions with the DNA minor groove. J. Biol. Chem. 273:19251-19259.[Abstract/Free Full Text]
  74. 38
  75. Parker, D., K. Ferreri, T. Nakajima, V. J. LaMorte, R. Evans, S. C. Koerber, C. Hoeger, and M. R. Montminy. 1996. Phosphorylation of CREB at Ser-133 induces complex formation with CREB-binding protein via a direct mechanism. Mol. Cell. Biol. 16:694-703.[Abstract]
  76. 39
  77. Radhakrishnan, I., G. C. Perez-Alvarado, D. Parker, H. J. Dyson, M. R. Montminy, and P. E. Wright. 1997. Solution structure of the KIX domain of CBP bound to the transactivation domain of CREB: a model for activator:coactivator interactions. Cell 91:741-752.[CrossRef][Medline]
  78. 40
  79. Ramirez, J. A., and J. K. Nyborg. 2007. Molecular characterization of HTLV-1 tax interaction with the KIX domain of CBP/p300. J. Mol. Biol. 372:958-969.[CrossRef][Medline]
  80. 41
  81. Ravnskjaer, K., H. Kester, Y. Liu, X. Zhang, D. Lee, J. R. Yates III, and M. Montminy. 2007. Cooperative interactions between CBP and TORC2 confer selectivity to CREB target gene expression. EMBO J. 26:2880-2889.[CrossRef][Medline]
  82. 42
  83. Rousset, R., C. Desbois, F. Bantignies, and P. Jalinot. 1996. Effects on NF-kappa B1/p105 processing of the interaction between the HTLV-1 transactivator Tax and the proteasome. Nature 381:328-331.[CrossRef][Medline]
  84. 43
  85. Scoggin, K. E., A. Ulloa, and J. K. Nyborg. 2001. The oncoprotein Tax binds the SRC-1-interacting domain of CBP/p300 to mediate transcriptional activation. Mol. Cell. Biol. 21:5520-5530.[Abstract/Free Full Text]
  86. 44
  87. Sharma, N., D. I. Lopez, and J. K. Nyborg. 2007. DNA binding and phosphorylation induce conformational alterations in the kinase-inducible domain of CREB. Implications for the mechanism of transcription function. J. Biol. Chem. 282:19872-19883.[Abstract/Free Full Text]
  88. 45
  89. Takahashi, T., N. Suwabe, P. Dai, M. Yamamoto, S. Ishii, and T. Nakano. 2000. Inhibitory interaction of c-Myb and GATA-1 via transcriptional co-activator CBP. Oncogene 19:134-140.[CrossRef][Medline]
  90. 46
  91. Takemori, H., J. Kajimura, and M. Okamoto. 2007. TORC-SIK cascade regulates CREB activity through the basic leucine zipper domain. FEBS J. 274:3202-3209.[CrossRef][Medline]
  92. 47
  93. Tie, F., N. Adya, W. C. Greene, and C. Z. Giam. 1996. Interaction of the human T-lymphotropic virus type 1 Tax dimer with CREB and the viral 21-base-pair repeat. J. Virol. 70:8368-8374.[Abstract]
  94. 48
  95. Trevisan, R., L. Daprai, L. Acquasaliente, V. Ciminale, L. Chieco-Bianchi, and D. Saggioro. 2004. Relevance of CREB phosphorylation in the anti-apoptotic function of human T-lymphotropic virus type 1 tax protein in serum-deprived murine fibroblasts. Exp. Cell Res. 299:57-67.[CrossRef][Medline]
  96. 49
  97. Trevisan, R., L. Daprai, L. Paloschi, N. Vajente, L. Chieco-Bianchi, and D. Saggioro. 2006. Antiapoptotic effect of human T-cell leukemia virus type 1 tax protein correlates with its creb transcriptional activity. Exp. Cell Res. 312:1390-1400.[CrossRef][Medline]
  98. 50
  99. Wagner, B. L., A. Bauer, G. Schutz, and M. Montminy. 2000. Stimulus-specific interaction between activator-coactivator cognates revealed with a novel complex-specific antiserum. J. Biol. Chem. 275:8263-8266.[Abstract/Free Full Text]
  100. 51
  101. Xu, W., L. H. Kasper, S. Lerach, T. Jeevan, and P. K. Brindle. 2007. Individual CREB-target genes dictate usage of distinct cAMP-responsive coactivation mechanisms. EMBO J. 26:2890-2903.[CrossRef][Medline]
  102. 52
  103. Yan, J. P., J. E. Garrus, H. A. Giebler, L. A. Stargell, and J. K. Nyborg. 1998. Molecular interactions between the coactivator CBP and the human T-cell leukemia virus Tax protein. J. Mol. Biol. 281:395-400.[CrossRef][Medline]
  104. 53
  105. Zhang, X., D. T. Odom, S. H. Koo, M. D. Conkright, G. Canettieri, J. Best, H. Chen, R. Jenner, E. Herbolsheimer, E. Jacobsen, S. Kadam, J. R. Ecker, B. Emerson, J. B. Hogenesch, T. Unterman, R. A. Young, and M. Montminy. 2005. Genome-wide analysis of cAMP-response element binding protein occupancy, phosphorylation, and target gene activation in human tissues. Proc. Natl. Acad. Sci. USA 102:4459-4464.[Abstract/Free Full Text]
  106. 54
  107. Zhao, L. J., and C. Z. Giam. 1991. Interaction of the human T-cell lymphotrophic virus type I (HTLV-I) transcriptional activator Tax with cellular factors that bind specifically to the 21-base-pair repeats in the HTLV-I enhancer. Proc. Natl. Acad. Sci. USA 88:11445-11449.[Abstract/Free Full Text]
  108. 55
  109. Zor, T., R. N. De Guzman, H. J. Dyson, and P. E. Wright. 2004. Solution structure of the KIX domain of CBP bound to the transactivation domain of c-Myb. J. Mol. Biol. 337:521-534.[CrossRef][Medline]
  110. 56
  111. Zor, T., B. M. Mayr, H. J. Dyson, M. R. Montminy, and P. E. Wright. 2002. Roles of phosphorylation and helix propensity in the binding of the KIX domain of CREB-binding protein by constitutive (c-Myb) and inducible (CREB) activators. J. Biol. Chem. 277:42241-42248.[Abstract/Free Full Text]


Molecular and Cellular Biology, February 2008, p. 1383-1392, Vol. 28, No. 4
0270-7306/08/$08.00+0     doi:10.1128/MCB.01657-07
Copyright © 2008, American Society for Microbiology. All Rights Reserved.




This article has been cited by other articles:

  • Kim, Y.-M., Sharma, N., Nyborg, J. K. (2008). The Proto-Oncogene Bcl3, Induced by Tax, Represses Tax-Mediated Transcription via p300 Displacement from the Human T-Cell Leukemia Virus Type 1 Promoter. J. Virol. 82: 11939-11947 [Abstract] [Full Text]  
  • Poon, S. L., An, B.-S., So, W.-K., Hammond, G. L., Leung, P. C. K. (2008). Temporal Recruitment of Transcription Factors at the 3',5'-Cyclic Adenosine 5'-Monophosphate-Response Element of the Human GnRH-II Promoter. Endocrinology 149: 5162-5171 [Abstract] [Full Text]  
  • Sharma, N., Nyborg, J. K. (2008). The coactivators CBP/p300 and the histone chaperone NAP1 promote transcription-independent nucleosome eviction at the HTLV-1 promoter. Proc. Natl. Acad. Sci. USA 105: 7959-7963 [Abstract] [Full Text]  

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Geiger, T. R.
Right arrow Articles by Nyborg, J. K.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Geiger, T. R.
Right arrow Articles by Nyborg, J. K.