Spn1 Regulates the Recruitment of Spt6 and the Swi/Snf Complex during Transcriptional Activation by RNA Polymerase II

We investigated the timing of the recruitment of Spn1 and itspartner, Spt6, to the CYC1 gene. Like TATA binding protein andRNA polymerase II (RNAPII), Spn1 is constitutively recruitedto the CYC1 promoter, although levels of transcription fromthis gene, which is regulated postrecruitment of RNAPII, arelow. In contrast, Spt6 appears only after growth in conditionsin which the gene is highly transcribed. Spn1 recruitment isvia interaction with RNAPII, since an spn1 mutant defectivefor interaction with RNAPII is not targeted to the promoter,and Spn1 is necessary for Spt6 recruitment. Through a targetedgenetic screen, strong and specific antagonizing interactionsbetween SPN1 and genes encoding Swi/Snf subunits were identified.Like Spt6, Swi/Snf appears at CYC1 only after activation ofthe gene. However, Spt6 significantly precedes Swi/Snf occupancyat the promoter. In the absence of Spn1 recruitment, Swi/Snfis constitutively found at the promoter. These observationssupport a model whereby Spn1 negatively regulates RNAPII transcriptionalactivity by inhibiting recruitment of Swi/Snf to the CYC1 promoter,and this inhibition is abrogated by the Spn1-Spt6 interaction.These findings link Spn1 functions to the transition from aninactive to an actively transcribing RNAPII complex at a postrecruitment-regulatedpromoter.

INTRODUCTION

Top

INTRODUCTION

For a large number of well-characterized genes, the rate-limitingstep in the transcription process is the formation of the preinitiationcomplex at the promoter. At these genes, the recruitment ofTATA binding protein (TBP) and RNA polymerase II (RNAPII) tothe promoter correlates strongly with transcriptional output(35, 41, 67). Indeed, delivery of TBP and RNAPII appears tobe sufficient for gene activation in many contexts (for reviews,see references 63 and 64). However, there are a growing numberof genes that have been found to be regulated at a step afterthe recruitment of RNAPII. Such genes include the yeast CYC1gene, the Drosophila heat shock genes, and mammalian human immunodeficiencyvirus type 1 and the c-Myc proto-oncogene (3, 39, 41, 51, 77).Indeed, whole-genome studies suggest that a significant portionof the human genome may be regulated postrecruitment of RNAPII(26, 35). As such, these mechanisms have the potential to impactthe expression of thousands of human genes. Our understandingof these mechanisms and the rate-limiting steps involved isincomplete, but these observations suggest that functions criticalfor a high level of transcription are either inhibited or absentunder noninducing conditions. To determine the nature of thesefunctions, further characterization of genes regulated afterthe assembly of the general transcription machinery is imperative.

The yeast CYC1 gene encodes iso-1-cytochrome c, a protein involvedin the electron transport chain in the mitochondria (75). Inthe presence of a fermentable carbon source (such as dextrose),CYC1 gene expression is inhibited and transcriptional levelsare extremely low (24, 25). When cells are grown on a nonfermentablecarbon source (such as lactate or ethanol), CYC1 is activatedand transcriptional output is induced approximately 10-fold.In contrast to these dramatic changes in transcriptional output,the occupancy of TBP and RNAPII at the CYC1 promoter changesvery little during the carbon source change (41, 51). Thus,CYC1 gene expression is regulated at a step after the recruitmentof these two essential members of the general transcriptionmachinery. Postrecruitment mechanisms of gene regulation havebeen observed in all organisms, ranging from bacteria to yeaststo flies to humans (3, 35, 39, 41, 51, 67). Thus, knowledgegained regarding postrecruitment regulation of gene expressionin the highly amenable yeast system has the potential to revealuniversal mechanistic insights.

SPN1, a gene that is essential in yeast and highly conservedthroughout evolution, appears to play a critical role in regulatingtranscription after assembly of the general transcription machinery.Mutation of SPN1 results in elevated levels of transcriptionfrom the CYC1 gene under noninducing (dextrose) conditions (19).Moreover, Spn1 genetically interacts with TBP and Spt4 and physicallyinteracts with Spt6, factors with known roles in transcriptioninitiation, elongation, processing, and chromatin remodeling(19, 21, 38, 46). Therefore, we set out to determine the functionalrequirement for Spn1 at the postassembly-regulated CYC1 gene.

We show that Spn1, like TBP and RNAPII, is constitutively recruitedto the CYC1 promoter. Moreover, TFIIH, capping enzyme, and serine-5phosphorylation of the C-terminal domain of Rpb1 are also presentat the CYC1 promoter prior to induction of transcription. Spn1is targeted to the promoter via interaction with RNAPII, sincean spn1 mutant defective for interaction with RNAPII fails tooccupy CYC1. Spt6 appears at CYC1 only after the gene is activated.In the absence of Spn1 promoter occupancy (in the spn1 mutantstrain), Spt6 is no longer recruited to the CYC1 promoter, indicatingthat Spn1 is necessary for Spt6 recruitment. In addition, theresults from a genetic screen reveal that the Swi/Snf chromatin-remodelingcomplex and Spn1 have strong antagonizing functions and thatrecruitment of Swi/Snf is also impacted by Spn1. Taken together,these studies indicate that Spn1 is essential for coordinatingthe recruitment of chromatin-remodeling factors for the properexpression of the postassembly-regulated CYC1 gene.

MATERIALS AND METHODS

Top

MATERIALS AND METHODS

Yeast strains. The deletion collection strains (83) and the parental BY4741strain (MATa his3 ${Delta}$ 1 ura3 ${Delta}$ 0 leu2 ${Delta}$ 0 met15 ${Delta}$ 0) were purchased from ResearchGenetics. A subset of these deletion strains was chosen to studythe genetic interactions between SPN1 and the genes deletedin these strains (see Table S1 in the supplemental material).For phenotypic studies, genomic SPN1 in these strains was deletedand covered by either wild-type SPN1 or spn1^K192N on plasmids.

The snf2 ${Delta}$ strain (MAT ${alpha}$ ada2 ${Delta}$ ada3 ${Delta}$ leu2 ${Delta}$ 1 ura3 ${Delta}$ 0 snf2::Kan^r) was kindlyprovided by Caroline Kane (15). The spt16-11 and pob3-7 mutantsand their parental strain (MATa trp1 leu2 ura3 his3) were providedby Timothy Formosa (20).

Yeast medium. Yeast media used to analyze phenotypic changes were made asdescribed in the literature (27). 5-Fluoroorotic acid plateswere made as described previously (7). YPGal and YPEG plateswere made by replacing the dextrose in YPD with 2% galactose,2% ethanol, and 2% glycerol. Plates containing sorbitol, NaCl,and H₂O₂ were made by supplementing YPD medium with 1 M sorbitol,1 M NaCl, and 4 mM H₂O₂. Medium lacking inositol (Ino^–)was made as described (30). Mycophenolic acid (MPA) plates weremade by supplementing SC-U plates with 20 µg/ml MPA.

Plasmid construction. A 2.2-kb fragment of the LEU2 gene containing its promoter,coding region, and terminator was amplified from yeast genomicDNA and subcloned into the pJF201 (TRP1 CEN) plasmid (19) toreplace the SPN1 open reading frame (ORF). The resulting plasmid,pLT-1, has the LEU2 gene flanked by the SPN1 promoter and terminatorand was used to produce the SPN1::LEU2 fragment for genomicSPN1 deletion. An SPN1-covering plasmid (pUS-1) was createdby ligation of the TOA1 promoter, SPN1 ORF, and TOA1 terminatorand subcloning into pRS316 (URA3 CEN). Two 1.7-kb fragmentscontaining the SPN1 promoter and terminator and either the wild-typeSPN1 ORF or spn1-K192N were isolated from pJF201 or pJF202,respectively, and subcloned into pRS313 (HIS3 CEN) to generatepHS-1 (wild type) and pHS-2 (spn1-K192N).

Genetic screen. To combine the spn1-K192N allele with the deletion mutants ofvarious RNAPII transcriptional factors, strains were transformedfirst with a URA3-marked engineered SPN1-encoding cover plasmid(pUS-1, which contains the promoter and terminator from TOA1).Subsequently, the genomic SPN1 ORF was deleted by LEU2 replacementusing the insert from pLT-1 and homologous recombination withsequences within the promoter and terminator of SPN1. The useof the TOA1 promoter and terminator on the plasmid-borne copyof SPN1 targeted the one-step disruption solely to the genomiccopy of SPN1. The deletion of genomic SPN1 in the mutant strainswas confirmed by PCR (data not shown). The SPN1 gene (wild type;pHS-1) or the spn1-K192N derivative (pHS-2) on a HIS3-markedplasmid was then introduced by plasmid shuffling. The expressionlevels of the plasmid-borne wild-type SPN1 and spn1-K192N moleculeare comparable to that of genomic SPN1 (data not shown). Toassay the genetic interactions of SPN1 with different transcriptionfactors, the strains were grown under 10 different conditions.Phenotypic changes were scored by comparing the growth of strainscovered by SPN1 versus spn1-K192N under the following conditions:30°C, 38°C, and 14°C; 1 M NaCl, 1 M sorbitol, 4mM H₂O₂, and Ino^– media; glucose versus galactose or ethanol/glycerolas a carbon source; 50 mM aminotriazole (AT); or growth on 20µg/ml MPA.

Transcriptional assays. S1 nuclease assays were conducted as described previously (19).For CYC1 induction, cultures grown overnight in rich mediumcontaining 2% glucose were washed three times in medium lackingglucose, diluted into medium containing 3% ethanol, and culturedat 30°C for 6 h. For uninduced samples, cells were grownin YPD for 6 h at 30°C until the optical density reached0.8 to 1.0. Yeast cells were then harvested, and total RNA wasisolated by hot-phenol extraction. Hybridizations with excessprobe were normally done with 25 to 30 µg of RNA sampleshybridized with excess ³²P-labeled probe overnight at 55°C.S1 nuclease digestion was performed on the hybridized samplesfor 30 to 45 min at 37°C. Band intensity was normalizedto the intensity of the tRNA^w band.

Coimmunoprecipitation experiments. Coimmunoprecipitation experiments were performed with the indicatedstrains (Table 1) as described previously (55) with a few modifications.Cultures were grown to an optical density (600 nm) of about1.0 in rich medium containing 2% dextrose. Cell extracts (300µg) were used immediately following preparation and wereprecleared by incubation with 50 µl plain protein A-Sepharosebeads (Pharmacia) for 1 h at 4°C. A small sample was takenafter the preclear step to provide a load control. Antihemagglutinin(anti-HA) (Santa Cruz), polyclonal anti-Spn1, and anti-Rpb1(8WG16; Covance, Inc.) antibodies were coupled to protein A-Sepharosebeads, and the remaining extract was incubated with 50 µlof these coupled beads for 2 h at room temperature with occasionalstirring. After six washes, the beads were boiled in loadingbuffer and 15 µl was loaded for sodium dodecyl sulfate-polyacrylamidegel electrophoresis, followed by immunoblot analysis.

View this table:
[in this window]
[in a new window]

TABLE 1. Yeast strains used for coimmunoprecipitation and ChIP studies

ChIP analysis. Chromatin immunoprecipitations (ChIPs) were performed with theindicated strains (Table 1) as described previously (79), witha few modifications. Cells (150 ml) were grown to an opticaldensity at 600 nm of 0.8 to 1.0. Cells were treated with a finalconcentration of 1% formaldehyde for 15 min, with occasionalswirling of the flasks at intervals of 5 min. Glycine was addedto a final concentration of 125 mM at room temperature and leftfor 5 min to stop cross-linking. Cells were collected and washedtwice in ice cold Tris-buffered saline. Cells were resuspendedin FA-lysis buffer (500 µl of FA-lysis buffer for a totalof 50 ml of cell culture). Chromatin was sheared by sonicationusing a Branson W-350 Sonifier (10 times at 10 seconds eachon continuous pulse at a microtip power setting of 6). A portion(10%) of the chromatin material used for the immunoprecipitationwas processed as the input after reversing the cross-links andpurifying the DNA. About 500 µl of the chromatin materialwas incubated with approximately 5 µl of either anti-Spn1,anti-HA (Santa Cruz), anti-Myc (Upstate), anti-RNAPII (8WG16;Covance, Inc.), or anti-serine 5-phosphorylated C-terminal domain(CTD) (H14; Covance, Inc.) antibodies by rotation overnightat 4°C. A 50-µl portion of protein-A Sepharose beads(Pharmacia; prepared as a slurry as per the manufacturer's directions)was further incubated with the chromatin material for 2 h at4°C. The beads were spun down, and the antigen-antibodycomplexes bound to the beads were recovered and further treatedwith Tris-EDTA-sodium dodecyl sulfate buffer for 15 min at 65°Cto elute the complexes. Protein-DNA cross-links were reversedby incubation overnight at 65°C, and the DNA was purifiedby phenol-chloroform extraction and used for the PCR analysis.

PCRs were carried out in a total volume of 25 µl. Eachreaction mixture contained 1 µl of a 1/100 dilution of10-mCi/ml ³²P-labeled dATP. Different dilutions of each inputand immunoprecipitated samples were used to determine the linearrange of the PCR. The PCR products were run on 5% native polyacrylamidegels in 0.5x Tris-borate-EDTA buffer. The gels were dried andexposed to a phosphorimage screen. Images were scanned by STORMand quantified using ImageQuant software analysis to detectthe strengths of various signals. The primers used to amplifythe promoter region of CYC1 (–234 to +79) were 5'AGGCGTGTATATATAGCGTGGAT3'and 5'CCACGGTGTGGCATTGTAGACAT3'. The signal strength ratio betweenthe immunoprecipitated sample and the input after subtractingthe signal of a no-antibody control was used as an indicationof the occupancy of the protein. Each experiment was repeated(from independent cultures of cells) a minimum of three times.

RESULTS

Top

RESULTS

Spn1 is found in association with Spt6 (21, 38), a factor withimportant functions for transcription through chromatin (2,8, 31). To examine the mechanistic relationship between Spn1and Spt6 at a promoter that is regulated postassembly of TBPand RNAPII, we examined their occupancy levels on the CYC1 genevia ChIP analysis. Occupancy levels of Spn1 on the CYC1 promoterare comparable under uninduced (partial repression) and induced(activation) conditions (Fig. 1A and C). Thus, Spn1 is constitutivelyrecruited to CYC1, like TBP and RNAPII (41, 51), In contrastto the case for Spn1, TBP, and RNAPII, occupancy levels of Spt6are low under uninduced conditions and increase more than fivefoldunder inducing conditions. Thus, Spn1 and Spt6 have separablefunctions prior to activation of CYC1, and the appearance ofSpt6 correlates with the transition to an actively transcribingRNAPII complex.

View larger version (15K):
[in this window]
[in a new window]

FIG. 1. Spn1 and Spt6 are not coordinately recruited to CYC1, although Spt6 occupancy is Spn1 dependent. ChIP analysis using no antibody (noAb), anti-Myc antibody (Myc), or anti-HA antibody (HA) was performed on strains grown for 6 h under uninduced (2% dextrose) or induced (3% ethanol) conditions. (A) Spn1 continually occupies CYC1, while Spt6 occupies CYC1 only during activation. A control strain containing no tagged factors (untagged) was compared to a strain containing Myc-tagged Spn1 (Myc-Spn1) and HA-tagged Spt6 (HA-Spt6) via a representative ChIP assay. (B) Spn1 and Spt6 do not occupy CYC1 in the spn1-K192N background. A control strain containing no tagged factors (untagged) was compared to a strain containing Myc-tagged mutant Spn1-K192N (Myc-spn1-K192N) and HA-tagged Spt6 (HA-Spt6) via a representative ChIP assay. (C) Quantification of the relative Spn1 and Spt6 occupancy levels observed under uninduced and induced conditions. IP denotes the factor that was immunoprecipitated, whereas Strain indicates either the wild-type (WT) or spn1-K192N (MT) background. The protein occupancy level is represented as the ratio of signal from IP samples to that of the input minus background of a no-antibody control (n = 4; P < 0.005). Error bars indicate standard deviations.

Diminished Spn1 occupancy results in failure to recruit Spt6 to CYC1. In the spn1-K192N mutant (where lysine at position 192 is replacedwith asparagine), CYC1 transcription levels are elevated undernoninducing conditions and are also abnormally high under inducingconditions (19). These alterations in CYC1 expression suggestthat RNAPII is in a transcriptionally more active state at CYC1in the mutant background and that a rate-liming step due toSpn1 functions has been removed. Occupancy levels of Spn1 andSpt6 were thus determined in the spn1-K192N background. Strikingly,the occupancy level of Spn1 is diminished under noninducingconditions in the spn1-K192N mutant, and this low level of occupancyis unchanged under fully inducing conditions (Fig. 1B and C).Occupancy levels of Spt6 are also diminished in the spn1 mutantbackground under both noninducing and inducing conditions. Thisindicates that the recruitment of Spt6 is dependent on the presenceof Spn1 and that neither Spn1 nor Spt6 is required to activatetranscription of CYC1. Indeed, transcription levels of CYC1are elevated under noninducing conditions in the spn1mutantbackground (19). This suggests that Spn1 is required to maintainthe diminished activity of RNAPII at the postassembly-regulatedCYC1 gene.

Distinct functions of Spn1 and Spt6 during RNAPII transcription. To investigate the requirement for Spt6 at CYC1, we utilizeda well-characterized mutant allele of SPT6, spt6-1004 (31),and examined CYC1 transcription. We found that activation ofCYC1 in a spt6-1004 mutant was decreased by 30% (Fig. 2A). Adecrease in CYC1 transcription in the spt6-1004 strain suggestsa positive role of Spt6 in regulating RNAPII transcription atCYC1. This is in striking contrast to the fivefold increasein CYC1 transcription observed in a strain containing the spn1-K192Nmutation (19).

View larger version (30K):
[in this window]
[in a new window]

FIG. 2. Different effects of SPT6 and SPN1 mutations on RNAPII transcription (A) Effect of spt6-1004 on the regulation of CYC1 activation. Total RNA from wild-type (WT) and spt6 mutant strains grown under partially repressed (in medium containing 2% dextrose) and activated (in medium containing 3% ethanol) conditions were analyzed by S1 nuclease assay using ³²P-labeled CYC1 and tryptophan tRNA probes. tRNA^w signal was used as a loading control to normalize the signal of CYC1 transcripts. A representative gel is shown. For quantification, the transcription level of CYC1 in the wild-type strain was set to 100%, and the values for the spt6 mutant strain from three independent experiments (±4%) are indicated. (B) Effect of an spn1 mutation on FLO8 transcription. Total RNA from wild-type and spn1 or spt6 mutant strains, grown at 30°C or after an 80-minute shift to 37°C, was subjected to Northern blot analysis for FLO8 RNA. The position of the transcript generated from the cryptic TATA element is indicated.

Although Spt6 can stimulate elongation in vitro on naked DNA(16), it also binds histones and has critical functions formaintaining and modifying chromatin during transcription elongationin vivo (2, 8, 31, 56). One molecular aspect of these chromatin-relatedfunctions of Spt6 is in reestablishing chromatin structure aftertranscription (31). For example, loss of the proper chromatinstructure in the spt6-1004 mutant results in transcription initiationby RNAPII from cryptic TATA sites within the coding regionsof certain genes, such as FLO8 (31). To determine if Spn1 isinvolved in this process, we tested the spn1-K192N strain forshort transcripts at FLO8. Unlike the spt6 mutant strain, thespn1 mutant strain showed no changes in FLO8 transcription (Fig.2B). Thus, although the Spn1/Spt6 complex is involved in regulationof CYC1 gene expression, these two proteins are also likelyto have additional and separable functions in overall regulationof gene expression.

Spn1 is recruited to the CYC1 gene via interaction with RNAPII. How is Spn1 recruited to the CYC1 promoter? Likely candidatesfor recruitment of Spn1 are TBP and RNAPII, since both are constitutivelyrecruited to the CYC1 gene even when it is partially or fullyrepressed (41, 51). Although SPN1 genetically interacts withTBP, Spn1 was not found to coimmunoprecipitate with TBP or TFIID(19), Thus, we tested the hypothesis that Spn1 is recruitedto CYC1 by interacting with RNAPII. Indeed, we found that Spn1coimmunoprecipitates with RNAPII (Fig. 3). These results areconsistent with other studies that demonstrate an interactionbetween RNAPII and Spn1 by coimmunoprecipitation and by tandemaffinity chromatography (38, 46). Strikingly, we found thatthe mutant form of Spn1, Spn1-K192N, fails to coimmunoprecipitatewith RNAPII (Fig. 3). This loss of interaction with RNAPII,coupled with the observation that Spn1 is no longer presentat the CYC1 promoter in the spn1-K192N strain, indicates thatthe Spn1-RNAPII interaction is essential for targeting Spn1to the CYC1 promoter.

View larger version (14K):
[in this window]
[in a new window]

FIG. 3. Spn1 associates with the RNAPII complex, whereas Spn1-K192N is diminished for this interaction. Protein extracts from strains were immunoprecipitated (IP) with protein A-Sepharose beads coupled with antibodies as indicated. Proteins of interest were detected by using corresponding antibodies or epitope tags and immunoblot analyses. Immunoprecipitation with anti-Spn1 antibodies ( ${alpha}$ -Spn1) pulled down RNAPII, and conversely, immunoprecipitation with antibodies to Rpb1, the largest subunit of RNAPII ( ${alpha}$ -RNAPII), pulled down Spn1. However, in the spn1-K192N mutant background, RNAPII association is significantly reduced with Spn1-K192N. Loads represent 10% of the input material for the IP (100% was loaded).

Additional members of the preinitiation complex are present on the CYC1 promoter under noninducing conditions. To investigate the potential rate-limiting step impacted bySpn1, we further characterized the promoter-bound complex foundat the CYC1 promoter. As previously noted (51), RNAPII occupiesthe CYC1 promoter prior to induction, with very little changeupon transcriptional activation (Fig. 4). Typically, the CTDof Rpb1 of RNAPII is hypophosporylated prior to initiation andbecomes hyperphosphorylated on serine 5 during the transitionfrom initiation to elongation (13, 37). Thus, this phosphorylationevent may be a good candidate for a rate-limiting step impactedby Spn1 functions. Rpb1 specifically phosphorylated on serine5 can be immunoprecipitated with the monoclonal antibody H14(9, 59). Strikingly, ChIP assays using H14 antibodies show thatthe CTD of Rpb1 is phosphorylated under noninducing conditionsat the CYC1 promoter (Fig. 4). Interestingly, this occupancylevel drops when transcriptional output is high (under inducingconditions), which may reflect the recruitment of hypophosphorylatedRNAPII during multiple rounds of transcription initiation. Thepresence of serine 5 phosphorylation on the CTD suggests thatTFIIH also occupies the promoter, since it possesses CTD kinaseas well as helicase activities (18, 48, 69, 73, 74). Indeed,tagged derivatives of two different subunits of TFIIH (Rad3and Ssl2, the two helicases) were clearly detected at the CYC1promoter prior to activation of gene expression (Fig. 4). Asubsequent step in the transcription process is the cappingof the transcript (33, 37). Thus, we next tested for the occupancyof Ceg1, a subunit of the yeast mRNA capping enzyme that hasbeen shown to directly contact the phosphorylated form of theCTD (70, 71). Ceg1 was also found to occupy the promoter priorto activation, and upon induction, Ceg1 occupancy increasedslightly (less than twofold) (Fig. 4). Taken together with theprevious observations that RNAPII and TBP occupy the CYC1 promoterprior to transcriptional activation, these results with serine5 phosphorylation, TFIIH, and capping enzyme occupancy indicatea remarkably complete preinitiation complex at the CYC1 promoter.Moreover, we must expand the screen for potential candidatesfor the rate-limiting step impacted by Spn1 function.

View larger version (16K):
[in this window]
[in a new window]

FIG. 4. Determination of the occupancy levels of additional initiation complex components at CYC1. ChIP analysis was performed using antibodies for Rpb1 (RNAPII), the serine 5 phosphorylation-specific antibody (Ser5-P), or Myc antibodies and the indicated Myc-tagged strains for helicase subunits of TFIIH (Rad3 and Ssl2) or a capping enzyme subunit (Ceg1), under uninduced and induced conditions. The protein occupancy level is represented as the ratio of signal from immunoprecipitation samples to that of the input minus background control (irrelevant antibodies for RNAPII and serine 5 phosphorylation and an untagged strain for the remainder). In each case n = 3, with P < 0.005. Error bars indicate standard deviations.

Genetic interactions of SPN1 with RNAPII transcription factors. To investigate the functional relationship between Spn1 andother proteins involved in the regulation of gene expression,a targeted genetic screen was designed to identify transcriptionfactors that genetically interact with SPN1. Eighty differentstrains were chosen from the yeast deletion collection (seeTable S1 in the supplemental material). These strains were selecteddue to the annotated functional activity of the deleted geneproduct in some stage of the transcriptional process. The factorsinclude subunits of chromatin-remodeling complexes (SWI/SNF,ISW, FACT, RSC, and CHD1) and -modifying complexes (SAGA, NuHAT,and histone deacetylases), Mediator complex, and elongationfactors, activators, and additional SPT genes. Since these factorshave defined functions in the transcription process, combiningthis subset of mutants with the spn1-K192N allele has the potentialto reveal SPN1 functions during RNAPII transcription. Each ofthe strains containing a unique deletion was combined with thespn1-K192N allele. Since SPN1 is essential for viability andspn1-K192N is a recessive allele, introduction of spn1-K192Ninto each deletion strain was accomplished via a genomic knockoutof SPN1 and plasmid shuffling (for details, see Materials andMethods). Strains with a deleted gene and spn1-K192N were comparedto the parent deletion strain containing wild-type SPN1 or astrain containing spn1-K192N. Eleven different conditions, includingvarious temperatures, different carbon sources, and a numberof stress-inducing agents, were assayed for phenotypic changes.A phenotypic change indicates a genetic interaction betweenSPN1 and the deleted gene. Of the 81 deletion strains tested,6 showed genetic interactions with spn1-K192N (Table 2 and Fig.5).

View this table:
[in this window]
[in a new window]

TABLE 2. Observed synthetic interactions between SPN1 and specific gene products involved in RNAPII-mediated transcription

View larger version (48K):
[in this window]
[in a new window]

FIG. 5. SPN1 genetically interacts with SNF2, SNF5, SNF6, RTF1, and DST1. Yeast cells of the indicated strains were diluted serially and plated onto the indicated medium. Pictures were taken after 2 to 3 days of growth. The growth defects of the rtf1 ${Delta}$ and dst1 ${Delta}$ strains are exacerbated by the mutation in SPN1. The temperature-sensitive phenotype of the spn1 mutant (spn1-K192N) is suppressed by snf2 ${Delta}$ , snf5 ${Delta}$ , and snf6 ${Delta}$ , and the growth defects of the Swi/Snf mutants are suppressed by spn1-K192N. WT, wild type; MT, mutant.

spn1-K192N is synthetically lethal with a deletion in SPT4 and exacerbates the phenotypes of deletions in RTF1 or DST1. As has been previously reported for another allele of SPN1 (46),deleting SPT4 results in cell inviability when combined withthe mutation in SPN1 (Table 2). Since Spt4 and the essentialgene product Spt5 are known to interact genetically and physicallywith Spt6 (29), this result is not unexpected. Human Spt4 andits binding partner Spt5 comprise the positive transcriptionelongation factor DRB sensitivity-inducing factor, which bindsdirectly to RNAPII (80, 84). Two other deletion strains showedsynthetic growth defects when combined with the spn1-K192N allele.Deletion of either RTF1 or DST1 when combined with the spn1-K192Nallele resulted in mild growth defects under a variety of conditions(Fig. 5). For the RTF1 deletion strain these conditions includedgrowth on ethanol/glycerol-containing media and Ino^– media.Similar to the case for SPN1 (19), RTF1 was originally identifiedin a screen for suppressors of a TBP mutant (78). Rtf1 is amember of the Paf1 complex (57). Exacerbation of several observablegrowth defects was also observed when spn1-K192N was combinedwith a deletion in DST1 (Fig. 5). DST1 encodes the general transcriptionfactor TFIIS (66). In contrast to these effects for SPT4, RTF1,and DST1, none of the other SPT genes, elongation factors, orPaf complex members tested exhibited genetic interactions withSPN1. Thus, the specific genetic interactions between SPN1,SPT4, RTF1, and DST1 suggest an important linkage to later stepsin the initiation process and the early steps in elongation.

spn1-K192N synthetically rescues the effects of deletions in Swi/Snf subunits. In contrast to the genetic effects observed with the above-describedstrains, in which double mutants were less healthy (or dead),combining the spn1-K192N allele with deletions in three othergenes resulted in cells that grow significantly better (Table2 and Fig. 5). Enhanced growth/synthetic rescue is seen uponcombining spn1-K192N with a deletion for genes encoding threedifferent subunits of the Swi/Snf complex: SNF2, SNF5, and SNF6.Swi/Snf is an ATP-dependent chromatin-remodeling complex (fora review, see reference 52). Deletion of SNF2 alone causes severegrowth defects under all assay conditions, while snf5 ${Delta}$ and snf6 ${Delta}$ mutants are similar to each other and exhibit growth defectson galactose or ethanol/glycerol media, Ino^– plates, orplates containing hydrogen peroxide, AT, or MPA. Importantly,all of these growth defects are suppressed by spn1-K192N. Morestrikingly, these three Swi/Snf mutants also suppress the temperature-sensitivephenotype of spn1-K192N (Fig. 5). We did not observe geneticinteractions with four other genes that encode products foundin this complex. However, SNF2 encodes the enzymatic ATPasesubunit of the complex (60), and Snf2 requires both Snf5 andSnf6 for proper function (12, 22, 43). As such, SPN1 geneticallyinteracts with the critical gene products of the Swi/Snf complexbut not with other related factors (see Table S1 in the supplementalmaterial), such as ATP-dependent chromatin-remodeling factors(such as ISW1, ISW2, CHD1, RAD26, ITC1, etc.), or chromatin-modifyingcomplexes (such as SAGA, other HATs, or histone deacetylases).

The strong genetic interaction between Spn1 and components ofthe Swi/Snf complex prompted us to explore the role of Swi/Snfin CYC1 transcription regulation. Using S1 nuclease assays,CYC1 transcripts were measured in the parental, spn1-K192N,snf5 ${Delta}$ , and snf6 ${Delta}$ strains, as well as spn1-K192N snf5 ${Delta}$ and spn1-K192Nsnf6 ${Delta}$ double mutant strains. Consistent with our previous studies,the K192N mutation in SPN1 results in an additional fivefoldincrease in CYC1 transcription under inducing conditions (19).Deletion of SNF5 or SNF6 results in a 50 or 35 percent decrease,respectively, in CYC1 transcription compared to that in thewild-type parental strain (Fig. 6A). This indicates that thefunction of the Swi/Snf complex is required for normal levelsof CYC1 transcription. Mutating SPN1 in these Swi/Snf deletionstrains restored CYC1 transcription to normal levels. Theseeffects were not due to changes in Spn1 protein levels in theSwi/Snf mutant backgrounds, as immunoblot analysis indicatesno changes in Spn1 levels in the different strain backgrounds(Fig. 6B). Taken together, the results support our genetic observationsand imply a counteracting effect between Spn1 and the Swi/Snfcomplex at a molecular level.

View larger version (17K):
[in this window]
[in a new window]

FIG. 6. The Swi/Snf complex is required for full activation of the CYC1 gene. (A) Quantification of the effects of Swi/Snf mutants on CYC1 transcription. S1 nuclease assay results show the effects of the Swi/Snf complex on CYC1 activation. The indicated strains were grown under uninduced and induced conditions, and total RNA was isolated and analyzed via S1 nuclease assay. tRNA^w signal was used as a loading control to normalize signals of CYC1 transcripts. The fold changes in induction were calculated by dividing the signals of CYC1 transcripts under inducing conditions by the amount observed under noninducing conditions. The bar graph shows fold changes (mean ± standard deviation; P < 0.005) of CYC1 levels from each strain of four separate experiments. (B) Spn1 levels were comparable in all strains tested. Protein extracts from the indicated strains were analyzed by Western blotting using polyclonal anti-Spn1 antibody. TBP expression levels were used as an internal control. WT, wild type; MT, mutant.

Snf2, the ATPase subunit of Swi/Snf, is recruited to CYC1 during activated transcription. Since deleting components of the Swi/Snf complex resulted intranscriptional defects in CYC1 expression, we next investigatedwhether this was a direct effect of the functional activityof Swi/Snf at the CYC1 promoter. An epitope-tagged version ofSnf2 (the ATPase subunit) was created and used in a ChIP assayto determine the occupancy of Snf2 at the CYC1 promoter. Wefound that Snf2 shows a significant increase (fivefold) in occupancyat CYC1 under inducing conditions (Fig. 7). Thus, like for Spt6,the appearance of Snf2 at the postassembly-regulated CYC1 genecorrelates with the transition to a highly active RNAPII state.

View larger version (40K):
[in this window]
[in a new window]

FIG. 7. Occupancy of Swi/Snf on the CYC1 promoter during activation in wild-type and spn1^K192N backgrounds. ChIP analysis was performed on strains, as indicated in Fig. 1. (A) Swi/Snf occupies CYC1 during activation in a wild-type background. (B) The Swi/Snf complex autonomously occupies CYC1 in the spn1-K192N background. (C) Quantification of the relative Swi/Snf occupancy levels under uninduced and induced conditions. The protein occupancy level is represented as the ratio of signal from immunoprecipitation (IP) samples to that of the input minus background of a no-antibody control (n = 4; P < 0.005). WT, wild type; MT, mutant. Error bars indicate standard deviations.

Diminished Spn1 occupancy leads to autonomous recruitment of Snf2 at CYC1. The genetic suppression between mutants of Spn1 and the Swi/Snfcomplex and their opposite effects on transcription of the CYC1gene suggest a simple model whereby Spn1 antagonizes the functionof Swi/Snf. One way to accomplish this would be for Spn1 toinhibit Swi/Snf recruitment to the gene until inducing conditionsare present. If correct, then this model predicts that in theabsence of Spn1, the Swi/Snf complex would be constitutivelyrecruited to the CYC1 promoter. We tested this hypothesis byperforming ChIP assays in a spn1-K192N background, in whichSpn1 fails to occupy the CYC1 promoter. In contrast to the casefor wild-type cells, which showed low levels of Snf2 duringpartial repression, we found high occupancy levels of Snf2 atthe CYC1 gene in the mutant strain (Fig. 7). The autonomousincrease in recruitment of this component of Swi/Snf in themutant SPN1 strain is in good accord with the elevated levelsof transcription also observed in this strain (19). Taken together,these results suggest that Spn1 plays an inhibitory role inthe recruitment of the Swi/Snf complex.

Spt6 is recruited before Swi/Snf during CYC1 activation. If Spn1 has an inhibitory effect on the recruitment of the Swi/Snfcomplex during partial repression, then how is this relationshipaltered under inducing conditions, considering that Spn1 stilloccupies the promoter? One possibility is that the direct interactionof Spn1 with Spt6 abrogates the inhibitory activity. If thismodel is correct, than Spt6 would appear at the promoter priorto Swi/Snf. CYC1 transcription reaches maximum levels at approximately6 h of growth in medium containing ethanol (Fig. 8A). One hourafter activation, Spt6 occupancy levels reach over 70% of themaximum level (Fig. 8B and D). In contrast, occupancy levelsof the Swi/Snf complex increase at around 2 h after activationand reach the maximum at the 4-h time point (Fig. 8C and D).As such, Swi/Snf occupancy correlates well with CYC1 transcriptionlevels. The fact that Spt6 is recruited earlier than Swi/Snfupon activation supports a model whereby the interaction ofSpt6 with Spn1 relieves the inhibitory effect of Spn1 on therecruitment of the Swi/Snf complex.

View larger version (16K):
[in this window]
[in a new window]

FIG. 8. Time course of transcription and occupancy levels of Spt6 and Swi/Snf at CYC1. (A) S1 nuclease assay showing the time course of CYC1 activation. CYC1 is fully activated at 6 h of induction (medium containing 3% ethanol); tRNA was used as a loading control. (B) ChIP analysis showing the increase of Spt6 occupancy on the CYC1 promoter during 0 to 5 h of activation. Spt6 occupies the CYC1 promoter within 2 h after activation. (C) ChIP analysis showing the increase of the Swi/Snf complex occupancy on the CYC1 promoter during 0 to 5 h of activation. Swi/Snf occupancy parallels that of CYC1 transcription output. (D) Line graph showing the time course of Spt6 and Swi/Snf occupancy levels on the CYC1 gene upon activation. The levels of Spt6 and Swi/Snf occupancies at 6 h of activation were set as 100%. The occupancy levels of both factors at each time point were converted to the percentage of their maximum occupancy levels and graphed (n = 3; P < 0.005). Error bars indicate standard deviations.

DISCUSSION

Top

DISCUSSION

SPN1 encodes a highly conserved protein with an essential rolein transcription by RNAPII (19, 38, 46). To further define howSpn1 regulates RNAPII transcription, a targeted genetic screenwas designed to identify transcription factors that geneticallyinteract with SPN1. We found that SPN1 interacts with threeSwi/Snf genes (SNF2, SNF5, and SNF6), and SPT4, RTF1, and TFIIS(DST1). A number of lines of evidence suggest that the geneticinteractions we identified are biologically significant. First,the genetic interactions observed were highly specific: onlyfive transcription factors from over 80 strains tested showan interaction with SPN1. We did not observe phenotypic changesupon combining spn1-K192N with other deletion mutations of thetranscription machinery, such as Mediator components, RNAPII-associatedfactors, and different chromatin-remodeling and -modifying factors.Second, we observed that SPN1 genetically interacts with onlyone ATP-dependent chromatin-remodeling complex, Swi/Snf, andnot with other ATP-dependent chromatin-remodeling or -modifyingfactors such as Isw1, Isw2, FACT, RSC, or SAGA. Third, mutationsin SPT6 also suppress the transcription defects of Swi/Snf mutantstrains (28, 44, 82) and are synthetically lethal with a DST1(TFIIS) null mutant (15, 29). Fourth, synthetically lethal interactionshave been observed between a deletion of SPT4 and deletionsof RTF1 (14, 42) or DST1 (29). Taken together, these resultsindicate an extensive set of genetic and biochemical interconnectionsbetween Spn1, Spt6, Swi/Snf, Spt4, Rtf1, and TFIIS (DST1).

To further characterize the functional aspects of SPN1, we examinedoccupancy of a number of components of the transcriptional machineryto arrive at a working model for CYC1 gene activation (Fig.9). Like TBP and RNAPII (41, 51), we find that Spn1 occupiesthe CYC1 promoter under noninducing conditions. In addition,TFIIH and capping enzyme also appear to occupy the promoterprior to activation, and consistent with this, serine 5 of theCTD of Rpb1 is also phosphorylated. Spn1 appears to be recruitedto the promoter via interactions with RNAPII, since the SPN1mutant (spn1-K192N), which is defective for interaction withRNAPII, does not occupy the CYC1 promoter. Under inducing conditionsfor CYC1, Spt6 promptly occupies the promoter. Spt6 recruitmentis most likely via interaction with Spn1, since a loss of Spn1at CYC1 also results in the loss of Spt6 in the spn1-K192N background.After Spt6 is recruited, the Swi/Snf complex occupies the CYC1promoter. Swi/Snf recruitment correlates the best with transcriptionaloutput, suggesting that this is an important step in CYC1 geneexpression. Indeed, in the absence of Spn1 (as well as Spt6),Swi/Snf is constitutively recruited to CYC1, indicating thatSpn1 negatively regulates Swi/Snf recruitment.

View larger version (45K):
[in this window]
[in a new window]

FIG. 9. A model for CYC1 gene regulation. (A) Under uninduced conditions, Spn1, TBP, RNAPII, TFIIH, and the capping enzyme subunit, Ceg1, are constitutively recruited to the CYC1 gene. In addition, serine 5 of the CTD of Rpb1 is phosphorylated. Spn1 occupancy prevents Swi/Snf interaction with the CYC1 promoter. (B) Under inducing conditions, Spt6 is recruited to the CYC1 promoter via interaction with Spn1. (C) Spt6 recruitment is followed by the recruitment of the Swi/Snf complex, which correlates with induced levels of gene expression (arrow).

The model described above indicates that Spn1 and Spt6 havedistinct but dependent functions for CYC1 regulation. Are Spn1and Spt6 functions always codependent? Most likely they arenot, since we found that Spn1 does not appear to play a rolein cryptic start site formation, whereas Spt6 does (31). Inaddition, others have shown that mutations in SPN1 have no effecton Spt6-mediated chromatin reassembly at PHO5 (2) and that patternsof gene perturbations in microarray studies are fairly distinctfor mutations in SPN1 compared to SPT6 (10). All of the abovesuggests that although Spn1 and Spt6 cooperate for regulationof CYC1 gene expression, they also have additional and separablefunctions in overall regulation of gene expression.

Since Swi/Snf is a chromatin-remodeling complex (for a review,see reference 52), it is likely to be needed at CYC1 to perturbhistone-DNA interactions. Like the majority of yeast promoters(6, 45, 72), CYC1 is "open" and devoid of histones (51), andthus it is unlikely that Swi/Snf is required for promoter chromatinremodeling. In contrast to the promoter region, the ORF of CYC1has detectable levels of histone H3, and deletion of SNF5 resultsin a two- to threefold increase in histone occupancy in thisregion (data not shown). Thus, these results are consistentwith a role of the Swi/Snf complex in mobilizing histones inthe transcribing region. This could enhance the transcriptionalelongation process. Indeed, Swi/Snf has established roles indirecting remodeling of large chromatin domains encompassingcoding regions (36).

It is interesting to note that Swi/Snf has also been implicatedin promoter clearance by RNAPII (23). These results, coupledwith ours demonstrating that Swi/Snf recruitment correlateswith active RNAPII, makes one wonder whether Swi/Snf may facilitate"remodeling" of some other component in the system in additionto nucleosomes. Perhaps RNAPII itself may need to alter itsconformation to achieve an active transcribing and/or elongatingstate at CYC1. The high-resolution structures of the preinitiatedand elongating polymerase suggest that conformational changesmust occur to accommodate specific promoter recognition, DNAmelting, RNA chain extension, etc. (11, 32, 81, 85). Moreover,a large number of poised RNAPIIs (65), as well as partial preinitiationcomplexes (87), have been detected at various locations in theyeast genome without corresponding transcriptional activity.It is unknown how these inactive complexes are converted intoactive ones, but it is interesting to speculate that chromatin-remodelingcomplexes may have other fundamental targets besides nucleosomesand that these remodeling events may play a role in the transitionto competent elongation complexes.

We also found that spn1-K192N is synthetically lethal with adeletion in SPT4 (this was also observed by Lindstrom et al.[46]) and exacerbates the phenotypes of deletions in DST1 (TFIIS)or RTF1. Interestingly, each of these gene products plays apotential role in the transition to a competent elongation complex.Spt4 (in combination with Spt5) is implicated in regulatingthe elongation process (46). The human homologues of Spt4 andSpt5 comprise the positive transcription elongation factor DRBsensitivity-inducing factor, which binds directly to RNAPIIand plays a role in release from pausing of RNAPII (80, 84).TFIIS (DST1) plays a role in the initiation of transcription(62) and promoter escape (49) and also rescues arrested RNAPIIat pause sites by stimulating the RNAPII to cleave and realignthe nascent transcript (1, 4, 40). All of these observationsplace Spt4 and TFIIS firmly in a multifunctional role that isconsistent with the initiation-to-elongation transition. Likewise,RTF1 has been implicated in a number of stages in the RNAPII-mediatedtranscription process, including transcript start site selection,elongation, processing, and histone modifications (14, 29, 50,58, 76, 78). Like for these other multifunctional factors withwhich Spn1 genetically interacts, our data strongly suggestthat Spn1 negatively regulates the transition to a productiveelongation complex. Release of this inhibition, either by lackof recruitment (in the spn1-K192N mutant) or via interactionwith Spt6, allows for productive transcription. In addition,Spn1 colocalizes with RNAPII along the entire ORFs of a numberof constitutively active genes (34, 38). Also, Spn1 associateswith RNAPII phosphorylated on serine 5 and serine 2 residuesof the CTD of the largest subunit of RNAPII (46). Phosphorylationof the CTD is thought to correlate with stages of the transcriptionprocess in that hypophosphorylated RNAPII binds to promoters,serine 5 phosphorylation occurs during initiation, and serine2 phosphorylation occurs during elongation (for reviews, seereferences 54 and 61). Consistent with a novel and negativerole in the elongation process, the spn1-K192N mutant does notdisplay 6-azauracil or MPA sensitivity (19), two common phenotypesshared by many mutants with mutations in factors with positiveroles in elongation (29, 62, 68). These compounds alter theelongation rate and processivity of RNAPII in vivo (53), dueto depletion of nucleotide pools (17).

The extensive primary amino acid sequence identity between yeastand human Spn1 (19), as well as the existence of homologuesfor the other transcription players involved, suggests the potentialfor conservation of Spn1 function in higher eukaryotes. As inyeast, mammalian Spn1 (also known as Iws1) is essential forcell viability (47). Moreover, expression of postrecruitment-regulatedhuman immunodeficiency virus type 1 requires functional Spn1and Spt6, as knockdown and mutational analyses demonstrate defectsin transcript production and processing (86). In addition, humanSpn1 is involved in the expression of the c-Myc proto-oncogene(86), another gene that is regulated after recruitment of thepreinitiation complex (5, 39). Thus, the exciting and emergingpicture is one in which Spn1 plays a central role in postrecruitmentmechanisms in humans as well as in Saccharomyces cerevisiae.

ACKNOWLEDGMENTS

We thank Timothy Formosa and Caroline Kane for providing yeaststrains and Xu Chen for data analysis and figure preparation.

This work was supported by grants from the National Institutesof Health to L.A.S. (GM056884) and F.W. (GM32967).

FOOTNOTES

* Corresponding author. Mailing address: Department of Biochemistry and Molecular Biology, Colorado State University, Fort Collins, CO 80523. Phone: (970) 491-5068. Fax: (970) 491-0494. E-mail: Laurie.Stargell{at}Colostate.edu

Published ahead of print on 17 December 2007.

Supplemental material for this article may be found at http://mcb.asm.org/.

Present address: Department of Dermatology, School of Medicine,University of Colorado Health Sciences Center, Aurora, CO 80045.

REFERENCES

Top