Skip to main page content

• HOME
• Current Issue
• Archive
• Alerts
• About ASM
• Contact us
• Tech Support
• Journals.ASM.org

This Article Abstract Full Text (PDF) Supplemental material Alert me when this article is cited Alert me if a correction is posted Services Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Reprints and Permissions Copyright Information Books from ASM Press MicrobeWorld Citing Articles Citing Articles via Google Scholar Google Scholar Articles by Lin, D. Articles by Tiedge, H. Search for Related Content PubMed PubMed Citation Articles by Lin, D. Articles by Tiedge, H.

 Previous Article  |  Next Article 

Molecular and Cellular Biology, May 2008, p. 3008-3019, Vol. 28, No. 9
0270-7306/08/$08.00+0     doi:10.1128/MCB.01800-07
Copyright © 2008, American Society for Microbiology. All Rights Reserved.

Translational Control by a Small RNA: Dendritic BC1 RNA Targets the Eukaryotic Initiation Factor 4A Helicase Mechanism ^,

Daisy Lin,^1,2 Tatyana V. Pestova,^2,3 Christopher U. T. Hellen,^2,3 and Henri Tiedge^1,2,4*

The Robert F. Furchgott Center for Neural and Behavioral Science, Department of Physiology and Pharmacology,¹ Program in Molecular and Cellular Biology,² Department of Microbiology and Immunology,³ Department of Neurology, State University of New York, Health Science Center at Brooklyn, Brooklyn, New York 11203⁴

Received 2 October 2007/ Returned for modification 7 November 2007/ Accepted 21 February 2008

Top ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES

 
Translational repressors, increasing evidence suggests, participate in the regulation of protein synthesis at the synapse, thus providing a basis for the long-term plastic modulation of synaptic strength. Dendritic BC1 RNA is a non-protein-coding RNA that represses translation at the level of initiation. However, the molecular mechanism of BC1 repression has remained unknown. Here we identify the catalytic activity of eukaryotic initiation factor 4A (eIF4A), an ATP-dependent RNA helicase, as a target of BC1-mediated translational control. BC1 RNA specifically blocks the RNA duplex unwinding activity of eIF4A but, at the same time, stimulates its ATPase activity. BC200 RNA, the primate-specific BC1 counterpart, targets eIF4A activity in identical fashion, as a result decoupling ATP hydrolysis from RNA duplex unwinding. In vivo, BC1 RNA represses translation of a reporter mRNA with 5' secondary structure. The eIF4A mechanism places BC RNAs in a central position to modulate protein synthesis in neurons.

Top ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES

 
Local protein synthesis at the synapse, increasing evidence suggests, is one of the key molecular mechanisms that underlie input-specific modulations of synaptic strength and consequently higher brain functions that rely on such synaptic plasticity. Translational control mechanisms in synapto-dendritic domains are thought to be essential for the long-term spatiotemporal modulation of mosaic local protein repertoires. Such mechanisms are therefore attracting increasing interest among neuroscientists and molecular and cellular biologists (reviewed in references 3, 11, 24, 26, 27, 51, 60, and 67).

At the same time, there has been growing awareness of the biological significance of small, functional RNAs in eukaryotic cells in general and in neurons in particular (2, 7, 11). Small, non-protein-coding RNAs (npcRNAs) (also known as untranslated RNAs) (9) may be particularly well suited as posttranscriptional regulators of gene expression that enhance brain-environment interactions (11). Neuronal BC1 RNA is a small dendritic npcRNA (64) that operates as a translational repressor (30, 65, 66). BC1 RNA, which is targeted to dendrites (38, 39) and is abundant at the synapse (13), represses translation at the level of initiation (65, 66).

In eukaryotes, translation initiation proceeds in three stages, each of which is mediated by a number of eukaryotic initiation factors (eIFs) (reviewed in references 25 and 43). An eukaryotic initiation factor 2 (eIF2)·GTP·GMet-tRNA_i ternary complex first binds to the 40S ribosomal subunit to form a 43S preinitiation complex. This complex is subsequently recruited to the mRNA, typically to the 5' cap structure, and scans to the initiator codon to form a 48S initiation complex. In the final step, this complex is joined by the large ribosomal subunit to form an 80S monoribosome complex ready for elongation. It is frequently the second step, recruitment of the 43S complex and 48S complex assembly, that is rate limiting and the target for regulation. This step is mediated by the eIF4 family of factors: eIF4A, an ATP-dependent RNA helicase that is thought to unwind duplex content in the 5' untranslated region (5' UTR) of the mRNA; eIF4E, a cap-binding protein; eIF4G, a large scaffold protein that interacts with eIFs 4A and 4E and with poly(A)-binding protein (PABP); and eIF4B, a cofactor which enhances the unwinding activity of eIF4A. eIF4A may operate, stimulated by eIF4B, either by itself or in the context of a heterotrimeric eIF4A/4E/4G complex known as eIF4F (43).

BC1 RNA blocks assembly of 48S initiation complexes (65, 66). Differential internal ribosome entry site (IRES) analysis has shown that candidate targets of BC1-mediated repression are restricted to the eIF4 family of factors, excluding eIF4E (66). BC1 RNA does not significantly interact with the RNA-binding domain of eIF4G, and it has been suggested that BC1-mediated translation repression is realized through interactions with eIF4A (65, 66). Additional contributions are possibly derived from interactions with PABP (30, 65, 66), an auxiliary factor in eIF4-dependent translation (43). A BC1-eIF4A scenario is consistent with the finding that a viral initiation mechanism that does not require eIF4A-mediated unwinding is refractory to BC1-mediated repression (66).

However, the BC1-eIF4A model has remained hypothetical, and the underlying molecular mechanism is unknown. Here we dissected the functional role of BC1 RNA in the eIF4A unwinding mechanism. We report that BC1 RNA and its proposed human analog BC200 RNA (63) both directly target eIF4A. They specifically block the factor's helicase activity and but stimulate its ATPase activity—thus, by definition, uncoupling eIF4A-mediated RNA duplex unwinding from ATP hydrolysis. The combined evidence indicates that BC1 and BC200 RNAs are translational repressors that specifically target the catalytic activity of eIF4A and therefore eIF4A-dependent translation initiation.

Top ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES

 
RNAs. Full-length BC1 RNA was generated from plasmid pBCX607 as described previously (65, 66). Full-length BC200 RNA was transcribed from plasmid pBC200CJG. U6 and U4 snRNAs were transcribed from plasmids pSP6-U6 and pSP6-U4, respectively (39, 65, 66). Full-length unmodified tRNA^Leu was transcribed from plasmid pRt460 (62), irrelevant (random-sequence) RNA of 147 nucleotides (nt) from plasmid pSL300 (6) after digestion with PstI. Plasmids pOT.CAT-A98 and pOT.CAT-A0 (courtesy T. Preiss, Victor Chang Cardiac Research Institute, Australia) were used to generate chloramphenicol acetyltransferase (CAT) mRNAs (47). In vitro-transcribed RNAs were phenol-chloroform extracted, ethanol precipitated, and further purified on Sephadex G-50 or G-25 columns (GE Healthcare). RNA duplexes were generated by annealing an oligonucleotide (Dharmacon) of either 10 nt (GCUUUACGGU) or 12 nt (GCUUUACGGUGC) with a 44-nt oligonucleotide (GGGAGAAAAACAAAACAAAACAAAACUAGCACCGUAAAGCACGC) to yield 10/44-nt or 12/44-nt duplexes as described previously (54). Short-strand and long-strand oligonucleotides were typically combined at a ratio of 1:1.25, although in some cases, a ratio of 1:1.5 was used. Spontaneous unwinding of resulting RNA duplexes was less pronounced at the 1.5 ratio, possibly because in the presence of a higher concentration of long-strand oligonucleotides, duplexes have a higher probability to reanneal after spontaneous unwinding.

Expression and purification of recombinant proteins. Plasmids pET(His_6--eIF4A), pET(His_6--eIF4B), pET28(His₆-eIF4GI_737-1116), and pET3B PABP-His have been described previously (32, 44, 65, 66). All protein purification procedures included high-salt washes on Ni²⁺-nitrilotriacetic acid beads (Qiagen) to minimize unspecific RNA binding. eIF4A, eIF4B, and eIF4GI_737-1116 were further purified according to previously published protocols with modifications. eIF4A was purified on a HiTrap Q high-performance (HP) column or by fast-performance liquid chromatography (FPLC) (32) on a Mono Q column (GE Healthcare), using a 100 to 800 mM KCl step gradient to elute eIF4A fractions at 300 to 400 mM KCl (33, 41). We used spectrophotometry to probe for possible contamination of eIF4A with RNA. Our eIF4A preparations yielded A₂₆₀/A₂₈₀ ratios of <0.57, indicating the RNA is not detectable in eIF4A protein samples by this method (56).

eIF4B was purified by FPLC (33) using a HiTrap heparin HP column, eIF4GI_737-1116 by FPLC (32) using a Mono S column (GE Healthcare). Linear gradients of 100 mM to 1 M KCl were applied, eluting eIF4B at approximately 500 mM KCl and eIF4GI_737-1116 at 290 mM KCl. PABP was further purified on a HiTrap heparin HP column, using a step gradient of 200 to 600 mM KCl to elute the protein at approximately 500 mM KCl.

The recently revised nomenclature of segment eIF4GI_737-1116 (28) has been used in this article.

EMSA binding experiments. RNA duplexes (12/44-nt) were used as substrates, labeled as described below (see "Helicase assays" below). In vitro-transcribed BC1 RNA was labeled analogously after treatment with Antarctic phosphatase (New England Biolabs). RNA duplexes or BC1 RNA (1 nM) was incubated with eIF4A (5 µM) in reaction buffer (20 mM HEPES [pH 7.5], 70 mM KCl, 2 mM dithiothreitol [DTT], 5 mM magnesium acetate) with RNasin (40 U) at room temperature for 10 min. Unlabeled RNAs (1 nM or in titrating concentrations as indicated) were added, and incubation continued at 35°C for 15 min. Electrophoretic mobility shift assay (EMSA) was performed as described previously (65, 66) by native polyacrylamide gel electrophoresis (PAGE) (15% acrylamide; acrylamide/bisacrylamide ratio of 19:1). Results were quantified using a Storm 860 phosphorimaging system with ImageQuant software (Molecular Dynamics).

For heterologous competitive binding assays, we chose to monitor the appearance of labeled RNA in the nonshifted (lower, "free") band. Although disappearance of labeled RNA from the shifted (upper, "bound") band should parallel its appearance in the lower, nonshifted band, we found that the latter appeared to plateau later than the former. Assuming sensitivity differences as an underlying cause, we decided to err on the side of caution and used the nonshifted band for quantification.

Equilibrium affinity constants were established using the homologous competitive binding approach (16, 35). Nonlinear regression was performed with KaleidaGraph software (Synergy Software). Affinity constants were calculated using the Munson-Rodbard correction (37) of the Cheng-Prusoff equation (12). Fifty percent inhibitory concentration (IC₅₀) values were analogously established by heterologous competitive binding experiments (35).

Helicase assays. RNA helicase assays were performed as described previously (54). The short-strand oligonucleotide was end labeled with [-³²P]ATP (10 pmol, 3,000 Ci/mmol). RNA duplexes were annealed in hybridization buffer (10 mM Tris-HCl [pH 7.5], 1 mM EDTA, 100 mM KCl) by heating to 95°C for 5 min and cooling for at least 15 min at room temperature. Annealed RNA duplexes were diluted in hybridization buffer to a final concentration of 20 fmol/µl for use in helicase assays.

BC1 RNA and other RNAs were heated for 10 min at 70°C and cooled for 10 min at room temperature. Reaction mixtures were assembled with BC1 RNA or other RNAs (50 nM), eIF4A (1.2 µM), eIF4B (0.5 µM), and PABP (1.2 µM) as indicated, and RNasin (40 U, Promega) in unwinding buffer (20 mM HEPES [pH 7.5], 70 mM KCl, 2 mM DTT, 5 mM magnesium acetate, 1 mM ATP), with an initial incubation at room temperature for 10 min. Labeled duplex RNA (2 nM) was added, and incubation continued at 35°C for 15 min. Reaction products were resolved by native PAGE (15% acrylamide). Results were quantified by phosphorimaging as described above.

ATPase assays. ATPase assays were performed as described previously (1, 41) with modifications. Reactions were carried out in 20 mM HEPES (pH 7.5), 70 mM KCl, 2 mM DTT, 5 mM magnesium acetate, RNasin (40 U), eIF4A (1.5 µM), eIF4B (0.5 µM), eIF4GI_737-1116 (0.5 µM), and BC1 RNA or other RNAs (14 µM), unless noted otherwise. After incubation for 5 min at room temperature, 1 µCi [-³²P]ATP (3,000 Ci/mmol) was added, and incubation continued at 35°C for 15 min. Reaction products were resolved by thin-layer chromatography (TLC) using polyethyleneimine cellulose sheets (Analtech) in a solvent containing 0.8 M LiCl and 0.8 M acetic acid (31). Results were quantified by phosphorimaging.

UV cross-linking. The protocols of Pestova et al. (45) and Pisarev et al. (46) were used, the latter if 4-thio-UTP (Ambion) was incorporated. BC1 RNA was in vitro transcribed in the presence of either [-³²P]UTP, [-³²P]ATP, or [-³²P]ATP and 4-thio-UTP, as indicated. Labeled BC1 RNA was heated for 10 min at 70°C and allowed to cool at room temperature for 10 min. Reactions were performed in reaction buffer (20 mM HEPES [pH 7.5], 70 mM KCl, 2 mM DTT, 5 mM magnesium acetate) with spermidine (0.25 µM), RNasin (40 U), eIF4A (1.0 µM), and labeled BC1 RNA in a 150-µl reaction mixture volume. Initiation factors were used at 1.0 µM, unless indicated otherwise. After an initial incubation for 5 min at room temperature, samples were irradiated for 30 min in a GS Gene Linker UV chamber (Bio-Rad) at 240 nm. With RNA that had been transcribed in the presence of [-³²P]ATP and 4-thio-UTP, the mixture being incubated included either ATP or ADP at 5 mM or no nucleotide, and UV cross-linking was done in a Stratalinker UV cross-linker 1800 (Stratagene) at 365 nm. Unbound RNA was digested with RNase A (0.7 U), RNase I (100 U), RNase T₁ (1,000 U), and RNase V1 (0.1 U) (Ambion) at 37°C for 30 min. Cross-link products were resolved by sodium dodecyl sulfate-PAGE (10% acrylamide).

Nucleotide concentrations in UV cross-linking experiments were in the range of 1 to 5 mM, i.e., at least 2- to 10-fold above the published K_m of eIF4A for ATP (33). Nucleotides used in this work were typically purchased from EMD Biosciences. According to the manufacturer, ADP preparations contain less than 0.1% ATP and less than 1% AMP-DNP (adenyl-5'-yl imidodiphosphate). In addition, when the purity of ADP was examined by TLC, we found that no ATP contamination was detectable in samples purchased from EMD Biosciences (see Fig. S1 in the supplemental material) or in samples purchased from Sigma (not shown).

Cell culture and in vivo translation. In vivo translation experiments were done in HEK293 cells (ATCC). Cells were grown in Dulbecco's modified Eagle medium (Invitrogen) supplemented with 10% (vol/vol) fetal bovine serum (HyClone) and 1% (vol/vol) penicillin. In general, 1 x 10⁵ cells per well were plated on 12-well plates without antibiotics. Cells were allowed to attach overnight and to reach at least 80% confluence prior to transfection.

RNAs used for transfection were in vitro transcribed and purified as described above. CAT-A98 and CAT-A0 mRNAs were 5' capped and either polyadenylated (A98) or not (A0). Small RNAs were cotransfected with either CAT-A98 or CAT-A0 mRNA using Lipofectamine 2000 (Invitrogen) in Opti-MEM (Invitrogen). In brief, transfections were performed with RNA and Lipofectamine at a ratio of 1:2.5 as described previously (30). CAT mRNAs were used at 0.1 µg. When BC1 RNA or U6 RNA was titrated during transfection, the overall amount of transfected npcRNA was kept constant by supplementation with random-sequence RNA to a combined total of 20 pmol.

Cells were exposed to the RNA/transfection mixture for 3 h. Subsequently, this medium was replaced with fresh, serum-containing medium, and incubation was continued for additional 3 h. Cells were collected, lysed, and probed for CAT protein using a CAT enzyme-linked immunosorbent assay (ELISA) kit (Roche). ELISA data were normalized to total protein concentrations of cells collected from each well.

Top ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES

 
High-affinity binding of BC1 RNA to eIF4A. BC1 RNA has been shown to interact with eIF4A (65, 66). Because eIF4A is a helicase that unwinds RNA duplexes, the question is raised whether interactions of BC1 RNA with eIF4A will impact the factor's ability to engage duplex RNA substrates. We first asked whether eIF4A-substrate and eIF4A-BC1 interactions are interdependent. We performed EMSAs to address this question. Using a labeled RNA duplex with single-stranded overhang as a substrate (54), we verified that eIF4A causes a shift in its mobility, indicating RNA-protein binding (Fig. 1A). This substrate shift was substantially diminished by substrate-equivalent concentrations of BC1 RNA but not by equivalent concentrations of other small RNAs (two snRNAs and a tRNA) or by a 147-nt irrelevant RNA of random sequence. U4 RNA was able to compete weakly with substrate, a result that is likely attributable to the fact that U4 RNA is a target of cellular helicase activity (52) and may therefore act as a substrate for eIF4A.

View larger version (19K): [in this window] [in a new window]

FIG. 1. BC1 RNA binds to eIF4A with high affinity. Heterologous and homologous competitive binding assays were performed with labeled and unlabeled RNAs as indicated, and complexes were resolved by EMSA. (A) BC1 RNA specifically displaced RNA duplexes from eIF4A (lanes 2 and 3), while U6 snRNA, tRNA, and an irrelevant RNA (random-sequence [RS] RNA) did not. Also, U4 snRNA, although slightly more substrate competitive, did not effectively displace duplex RNA from eIF4A. Longer exposure of gels (not shown) revealed residual duplex-eIF4A complexes at decreasing levels even in the presence of >10 nM BC1 RNA. The presence (+) or absence (–) of eIF4A and unlabeled RNA is shown above the gel. (B) Using the EMSA approach, complexes of eIF4A with duplex RNA substrate were titrated with BC1 RNA. Nonlinear regression revealed that BC1 RNA displaced RNA duplexes from eIF4A with an apparent IC50 of 8.5 nM. (C) In converse titrations under identical conditions, an apparent IC50 of 308 nM was obtained for the displacement of BC1 RNA from eIF4A by duplex RNA substrate. (D) In homologous competitive binding experiments, complexes of eIF4A with labeled BC1 RNA were titrated with unlabeled BC1 RNA. Nonlinear regression revealed an IC50 of 10 nM, on the basis of which an equilibrium dissociation constant of 0.2 nM was calculated (37) for the binding affinity between BC1 RNA and eIF4A.

The above data suggest that BC1 RNA impedes eIF4A-substrate interactions. We next quantified the mutual binding interactions of BC1 RNA and duplex RNA substrate with eIF4A, using heterologous competitive binding assays. Duplex RNA substrate was displaced from eIF4A by BC1 RNA with an apparent IC₅₀ of 8.5 nM (Fig. 1B). The IC₅₀ for the converse replacement (i.e., BC1 RNA displaced from eIF4A by duplex RNA substrate) under identical conditions was 308 nM (Fig. 1C). We conclude that binding of BC1 RNA to eIF4A interferes with the factor's ability to interact with duplex substrate, while conversely, duplex substrate is less effective in disrupting BC1-eIF4A interactions.

To establish the affinity of BC1 RNA for eIF4A, we performed homologous competitive binding assays (35). In such assays, a labeled ligand is competed off a protein by the same but unlabeled ligand in titrating concentrations, and binding curves are obtained by nonlinear regression. An example of a BC1-eIF4A binding curve is shown in Fig. 1D. Using the Munson-Rodbard correction (37) of the Cheng-Prusoff equation, the equilibrium dissociation constant was calculated from these experiments as 0.2 nM.

In summary, these experiments show that dendritic BC1 RNA binds to eIF4A with high affinity and in a manner that interferes with the factor's ability to engage duplex RNA substrate.

Inhibition of eIF4A helicase activity by BC1 RNA. The above results raise the question how binding of BC1 RNA to eIF4A will impact the catalytic activity of the factor. eIF4A is an ATP-dependent helicase that is thought to unwind, during translation initiation, double-stranded RNA segments in 5' UTRs of mRNAs (25, 43). We hypothesized that BC1 RNA may play a functional role in modulating the unwinding activity of eIF4A, and we performed RNA helicase assays to test this hypothesis.

RNA helicase assays examine the ability of a protein to unwind an RNA duplex into single-stranded RNA monomers (54). We first verified that eIF4A is an effective helicase in our test system (Fig. 2). We also confirmed that eIF4B, an eIF4A-stimulating factor (25, 53), further increased eIF4A helicase activity (Fig. 2C). In the presence of BC1 RNA, the ability of eIF4A to unwind RNA duplexes, either alone or in combination with eIF4B, was greatly reduced (Fig. 2) (see also Fig. S2 in the supplemental material). eIF4B-stimulated eIF4A helicase activity was further stimulated by the central (i.e., RNA- and eIF4A-binding) domain of eIF4G (see also Fig. S3 in the supplemental material). The degree of BC1 repression of eIF4A helicase activity remained unchanged, regardless of the presence of eIF4B and eIF4G (Fig. 2) (see Fig. S2 and S3 in the supplemental material). For controls, we used other small RNAs with stable secondary structure conformations, U6 snRNA, a tRNA, and a 147-nt irrelevant RNA of random sequence. eIF4A helicase activity was slightly reduced in the presence of these RNAs, but in no case did these changes reach statistical significance (Fig. 2). Taken together, the data indicate that BC1 RNA specifically inhibits eIF4A-mediated RNA duplex unwinding.

View larger version (18K): [in this window] [in a new window]

FIG. 2. BC1 RNA inhibits eIF4A helicase activity. RNA duplexes (10/44 nt, radiolabeled on the shorter strand) were used as substrates for eIF4A-dependent helicase activity in the presence of 1 mM ATP. (A) BC1 RNA specifically inhibited eIF4A-dependent RNA duplex unwinding. Other small untranslated RNAs, such as U6 snRNA, irrelevant random-sequence (RS) RNA, and a tRNA, did not significantly inhibit unwinding. The presence (+) or absence (–) of eIF4A, eIF4B, and unlabeled RNA is shown above the gel. The percentage of RNA duplex unwound for each reaction mixture represents the ratio of monomer signal divided by the sum of monomer signal plus duplex signal (as determined by phosphorimaging) and is shown below the gel. (B) Quantitative analysis confirmed that BC1 RNA specifically repressed eIF4A-dependent RNA unwinding. Results shown are corrected for spontaneous unwinding (i.e., dissociation into monomers in the absence of eIFs 4A and 4B). Data are presented in the format mean ± standard error of the mean (error bar) (n = 4). For statistical analysis, the Kruskal-Wallis nonparametric one-way analysis of variance was used. A P of <0.05 was obtained and considered significant. For post hoc analysis, the Mann-Whitney U test (comparison with reaction mixtures with no unlabeled RNA) was used, and the value for the reaction mixture with no unlabeled RNA was significantly different (P < 0.05) from the value for the reaction mixture containing BC1 RNA, as indicated by a bracket and asterisk. (C) PABP did not alter BC1-mediated inhibition of eIF4A-dependent and eIF4B-stimulated helicase activity. The duplex RNA substrate used in panel C was generated at a 1:1.5 strand ratio (see Materials and Methods) and displayed a higher overall degree of annealing than the one used in panel A (1:1.25 ratio). The resulting overall lower unwinding efficiency likely explains a correspondingly stronger dependence on eIF4B.

PABP has previously been shown to bind BC1 RNA (36, 66, 68). Data shown in Fig. S4 in the supplemental material indicate that this binding occurs with an equilibrium dissociation constant of 8 nM, i.e., with an affinity very similar to that of PABP to poly(A) tails of mRNAs (19; see also reference 30). Because PABP and eIF4A are both abundant proteins in the cell, it was conceivable that they would compete for BC1 RNA and that BC1-mediated repression of eIF4A helicase activity may thus be modulated by PABP binding to BC1 RNA. We tested this hypothesis and found that it had to be rejected. Figure 2C shows that the eIF4A helicase repression competence of BC1 RNA was unchanged in the presence of PABP (used at concentrations equimolar to eIF4A). The data indicate that BC1-PABP interactions do not directly impact the ability of BC1 RNA to inhibit the unwinding activity of eIF4A.

The above results show that dendritic BC1 RNA is a specific repressor of eIF4A's ability to unwind RNA duplexes. This repression competence is not directly modulated by interactions of BC1 RNA with PABP. The latter result is consistent with previous data showing that eIF4A and PABP are able to engage BC1 RNA simultaneously, i.e., do not compete while binding to the RNA (65, 66).

Stimulation of eIF4A ATPase activity by BC1 RNA. In the eIF4A catalytic cycle, ATP hydrolysis is assumed to provide the driving force for duplex RNA unwinding (14, 25). The question is thus raised whether the repression of eIF4A helicase activity by BC1 RNA is mediated through inhibition of ATP hydrolysis. A number of RNA aptamers, directed against eIF4A and generated by in vitro RNA selection, block the ATPase activity of eIF4A and repress cap-dependent translation (40). We therefore decided to use ATPase assays to ask whether BC1 RNA similarly blocks the ATP hydrolytic activity of eIF4A.

To our initial surprise, however, we found that BC1 RNA not only failed to inhibit eIF4A ATPase activity but actually stimulated it (Fig. 3). We observed that eIF4A displayed a low-level basal ATPase activity in the absence of RNA, and we verified that this basal activity was not attributable to ATPase contamination (see Fig. S5 in the supplemental material). BC1 RNA stimulated the basal eIF4A ATPase activity by about threefold, whereas other small RNAs (U6 snRNA and an irrelevant random-sequence RNA) produced neither inhibition nor stimulation (Fig. 3). In the presence of eIF4B and an eIF4A-binding central domain of eIF4G (eIF4GI_737-1116), the basal ATPase activity of eIF4A was moderately elevated, as has been reported previously (21, 31). This elevated level was again stimulated by BC1 by a factor of about three (Fig. 3C) (see also Fig. S5 in the supplemental material).

View larger version (17K): [in this window] [in a new window]

FIG. 3. BC1 RNA stimulates eIF4A ATPase activity. Products of [-32P]ATP hydrolysis were resolved by TLC. (A) BC1 RNA specifically stimulated eIF4A-mediated ATP hydrolysis, whereas U6 RNA and an irrelevant random-sequence (RS) RNA did not. The presence (+) or absence (–) of eIF4A and RNA is shown above the gel. The percentage of ATP hydrolysis for each reaction mixture was calculated as the ratio between Pi band intensity and the sum of Pi and ATP band intensities and is shown below the gel. (B) Quantitative analysis of ATP hydrolysis. For statistical analysis (n = 4), the Kruskal-Wallis test was used (P < 0.05). The Mann-Whitney U test was used to compare reaction mixtures with no RNA. The value for reaction mixture with no RNA was significantly different (P < 0.05) from the value for BC1 RNA, as indicated by a bracket and asterisk. (C) In the presence of eIF4B and an eIF4A-binding central domain of eIF4G (eIF4GI737-1116), the basal ATPase activity of eIF4A was moderately elevated, and this elevated level was analogously BC1 stimulated about threefold.

Single-stranded ribohomopolymers, such as poly(A), have often been used to stimulate eIF4A ATPase activity in vitro (31, 41). It could therefore not be ruled out that the central A22 homopolymeric region in BC1 RNA (17) was per se responsible for the observed stimulation of eIF4A-mediated ATP hydrolysis. However, when we used an A25 homopolymer, no significant stimulation of eIF4A ATPase activity was observed (see also Fig. S5C in the supplemental material).

The results therefore indicate that BC1 RNA is a specific stimulator of eIF4A-mediated ATP hydrolysis. Because BC1 RNA at the same time inhibits eIF4A-catalyzed duplex unwinding, it is inferred that by definition, BC1 RNA uncouples the helicase activity of eIF4A from its ATPase activity.

Interaction of human BC200 RNA with eIF4A. Dendritic BC200 RNA is the primate counterpart of rodent BC1 RNA (63). The two RNAs are of different evolutionary pedigree (i.e., are not orthologs), and functional similarities can therefore not be presupposed. Nevertheless, BC200 RNA has been shown to be a translational repressor that is effective in the same concentration range as BC1 RNA (30, 66). Is it possible that BC200 RNA and BC1 RNA perform analogous functions in translational control, using analogous repression mechanisms? We addressed this question by probing whether BC200 RNA targets the catalytic activity of eIF4A.

In helicase assays, BC200 RNA was a potent inhibitor of eIF4A's ability to unwind RNA duplexes (Fig. 4A). Quantitatively, the helicase repression efficiencies of BC200 RNA and BC1 RNA were undistinguishable (Fig. 4B). In ATPase assays, BC200 RNA stimulated eIF4A-dependent ATP hydrolysis about threefold (Fig. 4C and D), again in a manner indistinguishable from BC1 RNA. The combined results therefore suggest that BC1 RNA and BC200 RNA are functionally equivalent in their interactions with eIF4A.

View larger version (26K): [in this window] [in a new window]

FIG. 4. BC200 RNA targets eIF4A catalytic activity in a manner indistinguishable from that of BC1 RNA. Helicase and ATPase assays were performed as described in the legends to Fig. 2 and 3. (A and B) BC200 RNA inhibited eIF4A helicase activity. For statistical analysis (n = 4), the Kruskal-Wallis test was used (P < 0.01). The Mann-Whitney U test was used to compare reaction mixtures with no unlabeled RNA. The value for the reaction mixture with no unlabeled RNA was significantly different (P < 0.05) from the values for the reaction mixtures containing BC1 RNA and BC200 RNA, as indicated by brackets and asterisks. (C and D) BC200 RNA stimulated eIF4A ATPase activity. For statistical analysis (n = 4), the Kruskal-Wallis test was used (P < 0.05). The Mann-Whitney U test was used to compare reaction mixtures with no RNA. The value for the reaction mixture with no RNA was significantly different (P < 0.05) from the value for the reaction mixture with BC200 RNA, as indicated by a bracket and asterisk. BC200 RNA and U6 RNA were used at 10 µM.

Given the fact that the BC1 and BC200 genes arose independently in evolution (8, 63), the close functional correspondence between the two RNAs was not a priori expected (see Discussion).

Modulation of BC1-eIF4A interactions by eIF4B and ATP/ADP. During translation initiation, eIF4A entertains interactions with RNA substrate, with ATP, and with initiation factors eIF4B and eIF4G (25, 43). Any of these interactions may theoretically modulate BC1-eIF4A interactions, modulations which may in turn be relevant in the regulation of BC1 functionality.

We have investigated BC1-eIF4A interactions vis-à-vis duplex RNA substrate and eIF4B (Fig. 1 and 2). The eIF4A helicase repression ability of BC1 RNA was not overcome or abolished by the helicase stimulatory activity of eIF4B. Does BC1 RNA exclude eIF4B from eIF4A interactions? This question is complicated by the fact that despite ample evidence supporting the role of eIF4B in eIF4A-mediated translation initiation, to date, stable physical interactions between eIF4B and eIF4A have not been documented (25). However, both factors form a ternary complex with pateamine A, a small-molecule modulator of eIF4A activity (5, 34).

We therefore asked whether both eIF4A and eIF4B are able to bind to BC1 RNA, whether they are able to do so simultaneously, and whether binding of one factor impacts binding of the other. Using UV cross-linking assays to address these questions, we found that both factors bind BC1 RNA (Fig. 5). Cross-linking efficiency of BC1 RNA with eIF4A alone, although moderate (Fig. 5A and B), appeared stronger than that of eIF4A substrates, such as capped reovirus mRNA (1) or the IRES of the encephalomyocarditis virus (EMCV) (29). eIF4B was cross-linked to BC1 RNA with an efficiency that was dependent on the labeled nucleotide chosen for incorporation during in vitro transcription. Thus, a robust eIF4B band was obtained after UV cross-linking (followed by RNase digestion) with [³²P]UTP-labeled BC1 RNA (Fig. 5A). A weaker band was obtained with [³²P]ATP-labeled BC1 RNA, indicating that eIF4B binds BC1 RNA preferentially outside its A-rich regions (Fig. 5B). Conversely, eIF4A appears to cross-link better to [³²P]ATP-labeled BC1 RNA, although the difference was less pronounced in this case (Fig. 5A and B).

View larger version (27K): [in this window] [in a new window]

FIG. 5. Recruitment of eIFs 4A and 4B to BC1 RNA is mutually synergistic. UV cross-linking assays were performed with BC1 RNA labeled by in vitro transcription in the presence of either [32P]UTP (A) or [32P]ATP (B). (A and B) If offered jointly, eIFs 4A and 4B mutually stimulated each other's binding interactions with BC1 RNA. Note that eIF4B was offered at a 10-fold-lower concentration than eIF4A. Experiments were performed in the presence of 5 mM ATP. (C and D) Quantitative analysis of UV cross-linking. (C) eIF4B significantly enhanced BC1-eIF4A UV cross-linking efficiency as evaluated by a nonparametric Mann-Whitney U test (compared with reaction mixtures with no [–] eIF4B) (P < 0.05) (n = 4), as is indicated by a bracket and asterisk. (D) eIF4A significantly enhanced BC1-eIF4B UV cross-linking efficiency, as evaluated by a nonparametric Mann-Whitney U test (compared with reaction mixtures with no eIF4A) (P < 0.05) (n = 4) and indicated by a bracket and asterisk.

When binding concurrently to BC1 RNA, the levels of cross-linking products generated by each factor were significantly increased compared to levels generated by either factor binding in isolation (Fig. 5). Thus, BC1-eIF4B cross-linking was greatly increased in the presence of eIF4A even when the concentration of eIF4B was reduced to avoid overloading of the gel with cross-linking products (Fig. 5). In this case, eIF4B also cross-linked efficiently to [³²P]ATP-labeled BC1 RNA, indicating that eIF4B was now brought, by eIF4A, into closer proximity of an A-rich region of BC1 RNA. Vice versa, significantly increased BC1-eIF4A cross-linking was also observed in the presence of eIF4B (Fig. 5). Similar results were obtained when eIF4A and eIF4B were binding to BC1 RNA simultaneously at the same concentration (see Fig. S6 in the supplemental material).

The combined results suggest that eIFs 4A and 4B interact with BC1 RNA in a mutually synergistic manner. In contrast, enhancement of eIF4A cross-linking capacity with the EMCV IRES (i.e., substrate RNA) was dependent on a central domain of eIF4G, but not on eIF4B (29, 31). We therefore asked whether cross-linking of eIF4A to BC1 RNA is similarly enhanced by the central domain of eIF4G (eIF4GI_737-1116). This was not the case (see Fig. S7 in the supplemental material), indicating that BC1-eIF4A cross-linking, unlike substrate-eIF4A cross-linking, is not stimulated by eIF4A-eIF4G interactions. Pulldown experiments showed that eIF4A-eIF4G complexes formed normally in the presence of BC1 RNA (see Fig. S7 in the supplemental material). In summary, the above experiments indicate that in trilateral interactions, eIFs 4A and 4B strongly stimulate each other's binding to BC1 RNA. In addition, eIF4A interacts with BC1 RNA and eIF4G concurrently, although these interactions do not appear to be mutually synergistic.

The cross-linking pattern of BC1 RNA with initiation factors 4A, 4B, and 4G was thus fundamentally different from interactions of eIF4A substrate RNAs (such as reovirus mRNA and the EMCV IRES) toward these factors (29, 31, 50). Specifically, in direct contrast to eIF4A cross-linking with such RNA substrates, BC1-eIF4A cross-linking efficiency was significantly stimulated by eIF4B but was not enhanced by the central domain of eIF4G. We conclude that the interaction of BC1 RNA with these initiation factors is unique and specific.

BC1-eIF4A interactions are also modulated by ATP/ADP. In the presence of ATP, BC1-eIF4A cross-linking efficiency was more than 10-fold higher than in the absence of ATP (Fig. 6). Cross-linking of RNA substrate to eIF4A has also been shown to be ATP stimulated, although to a smaller degree (33). BC1-eIF4A cross-linking (Fig. 6) differs from substrate-eIF4A cross-linking in that the latter is least efficient in the presence of ADP (15, 33). The nonhydrolyzable ATP analog AMP-PNP stimulated BC1-eIF4A cross-linking to almost the same degree as ATP, while other nucleoside triphosphates were much less effective (see Fig. S8 in the supplemental material).

View larger version (16K): [in this window] [in a new window]

FIG. 6. BC1-eIF4A interactions are modulated by ATP and ADP. (A) ATP increased BC1-eIF4A cross-linking efficiency more than 10-fold (compared with cross-linking in the absence of nucleotide). ADP increased cross-linking efficiency fourfold. BC1 RNA was in vitro transcribed in the presence of 32P-labeled ATP and 4-thio-UTP. The presence (+) or absence (–) of eIF4A and nucleotide is shown above the gel. (B) Quantitative analysis of BC1-eIF4A UV cross-linking efficiency. For statistical analysis (n = 4), the Kruskal-Wallis nonparametric one-way analysis of variance was used (P < 0.05). For post hoc analysis, the Mann-Whitney U test was used to compare reaction mixtures with ATP. The value for reaction mixtures containing ATP was significantly different (P < 0.05) from the values for reaction mixtures with ADP and without nucleotides, as is indicated by brackets and asterisks.

Translational repression by BC1 RNA in living cells. We used HEK293 cells to probe BC1 translational repression competence in vivo. The rationale for this choice was based on (i) the fact that this cell line, as a human cell line, does not express rodent BC1 RNA and (ii) the observation that, as opposed to other human cell lines, it does not express endogenous BC200 RNA at detectable levels (see Fig. S9 in the supplemental material). Use of this cell line will therefore allow interpretation of transfection experiments without interference from endogenous BC1 or BC200 RNAs.

For a reporter, we used CAT mRNA. This mRNA features a 5' UTR of 106 nt that is predicted to fold into a secondary structure with a change in Gibbs free energy (G°) of –27.1 kcal/mol, necessitating unwinding for efficient initiation (20). CAT mRNA was cotransfected with BC1 RNA or control RNAs at various concentrations, and synthesis of CAT protein was measured by ELISA. Figure 7A and B show that translation of CAT mRNA in HEK293 cells was significantly inhibited by BC1 RNA, but not by control RNAs.

View larger version (21K): [in this window] [in a new window]

FIG. 7. BC1 RNA significantly represses translation of CAT mRNA in HEK293 cells. (A and B) BC1 RNA significantly inhibited translation of CAT mRNA (5' capped and A98 adenylated), while U6 RNA did not. Total amounts of transfected small npcRNAs were kept constant by supplementation with random-sequence (RS) RNA to a combined total of 20 pmol. RS RNA thus served as an internal control and calibrator. For statistical analysis, the Kruskal-Wallis test was used (P < 0.05). For post hoc analysis, the Mann-Whitney U test was used to compare reaction mixtures with no BC1 or U6 RNA. Values were significantly different (P < 0.05) from the value for no BC1 RNA for values of BC1 RNA in the range 10 to 20 pmol, as is indicated by brackets and asterisks. (C and D) BC1 RNA significantly repressed translation of polyadenylated and nonadenylated CAT mRNAs. (C) HEK293 cells were cotransfected with CAT-A98 mRNA and either BC1 RNA or U6 RNA. BC1 RNA significantly reduced translation of CAT-A98 compared with U6 RNA. (D) HEK293 cells were cotransfected with CAT-A0 mRNA (5' capped but not adenylated) and either BC1 RNA or U6 RNA. BC1 RNA significantly inhibited translation of CAT-A0 mRNA compared with U6 RNA. In general, CAT-A0 mRNA was translated less efficiently than CAT-A98 mRNA as noted before (47). Statistical analysis in panels C and D was done by the Mann-Whitney U test. Values that were significantly different (P < 0.05) from the value for the reaction mixture with U6 RNA are indicated by a bracket and asterisk. For panels A to D, n 4 for each panel shown.

It is possible that sequestration of PABP by BC1 RNA may contribute to BC1 translational repression competence (30, 65). We therefore used HEK293 cells to compare susceptibility to BC1-mediated repression of polyadenylated (A98) and nonadenylated (A0) CAT mRNA (Fig. 7C and D). The results show that translation of polyadenylated and nonadenylated CAT mRNAs was significantly repressed by BC1 RNA. Calibrated against U6 RNA, BC1 RNA repressed translation of polyadenylated CAT mRNA by 52%, while it repressed translation of nonadenylated CAT mRNA by 42%. Therefore, sequestration of PABP accounts for less than 20% of BC1 repression competence. Because PABP and eIF4A are the only bona fide targets of BC1 RNA in the eukaryotic translation pathway (30, 36, 65, 66, 68), we conclude that BC1-eIF4A interactions are key determinants of BC1 translational repression competence.

Top ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES

 
eIF4A, functional target of BC1 and BC200 RNAs. How do small RNAs administer translational control in neurons? Dendritic BC1 RNA is a translational repressor that operates at the level of 48S initiation complex assembly (65, 66). While BC1 RNA has been shown to bind to eIF4A and PABP (36, 65, 66), its mode of action and the functional relevance of these interactions were not understood. We now report that BC1 and BC200 RNAs specifically target the catalytic activity of eIF4A.

BC1-eIF4A interactions result in severely diminished helicase activity of the factor. At the same time, eIF4A ATPase activity is stimulated. By definition, therefore, the two interdependent components of eIF4A catalytic activity, ATP hydrolysis and RNA duplex unwinding, are uncoupled by BC1 RNA. While similar catalytic uncoupling has previously been reported for certain eIF4A mutants (41), eIF4A uncoupling by an effector RNA represents a novel helicase control mechanism.

eIF4A is a prototype member of the family of DEAD-box RNA helicases (14, 25). The eIF4A structure is characterized by two globular domains that are connected by a linker region. Both domains contain motifs that contribute to RNA binding, and it is possible that BC1 and BC200 RNAs, similar to duplex RNA substrate, interact with both domains of eIF4A, resulting in a compact conformation of the protein. Such interactions may in turn interfere with the ability of the factor to engage and unwind duplex substrate. The consequence, however, is not a general competitive inhibition of eIF4A catalytic activity but a separation of the helicase component of this activity from its ATPase component. Such separation, although as a phenomenon defined as uncoupling, does not necessarily imply that BC1 RNA targets the coupling mechanism per se. Two scenarios are possible. (i) BC1 RNA may pose as a faux substrate that induces eIF4A into ATP-consuming but futile unwinding attempts. The basis for uncoupling would in this case be the ability of BC1 RNA to lure eIF4A into unproductive engagements such that any attempted strand separation, which would require ATP hydrolysis, is immediately followed by reversion to the native BC1 structure. Such futile (i.e., nonproductive) RNA-induced ATPase activity has recently been reported for the Escherichia coli DEAD-box helicase DbpA (22). (ii) BC1 RNA may directly target the eIF4A coupling mechanism. ATPase-helicase coupling in eIF4A-type DEAD-box helicases is mediated by a conformational change that is transmitted through interdomain interactions between the protein's N-terminal and C-terminal domains (4, 14, 41, 57, 58). In particular, motif III, located in the N-terminal domain near the interdomain linker, and motif VI, located in the C-terminal domain near the interdomain linker, have been proposed to participate in coupling by serving as relays that transduce the energy derived from ATP hydrolysis to the process of RNA duplex strand displacement (4, 14, 58). BC1 RNA may disrupt the interdomain conformational change that drives strand separation, a disruption that would result in the failure to unwind and subsequent abortive release of duplex substrate RNA.

To distinguish between the two above scenarios, future work will have to establish the structural-functional basis of BC1-eIF4A interactions. Thus, if BC1 RNA acts as a mimic of eIF4A substrate, one would expect it to interact with substrate-binding motifs Ia, Ib, IV, and/or V of eIF4A (4). If, in contrast, BC1 RNA directly targets the eIF4A coupling mechanism, one would expect it to interact, instead or in addition, with coupling-requisite motifs III and/or VI.

Translational repression via the catalytic activity of eIF4A would selectively target mRNAs with 5' UTR structural content that rely on unwinding for efficient initiation (18, 20, 43, 61). Using differential IRES analysis, it has previously been shown that BC1 RNA is not effective in repressing translation initiation of mRNAs that do not require unwinding of 5' UTR secondary structure by eIF4A (65, 66). The current work now provides a mechanistic basis for this earlier observation. Future work will probe the repertoire of synaptically localized mRNAs for eIF4A/4B translational dependence and thus susceptibility to BC1- or BC200-mediated translational repression.

BC1 RNA, eIF4A, eIF4B, and PABP. In eukaryotic translation initiation, eIF4A, eIF4B, and PABP functionally interact during recruitment of the 43S preinitiation complex to the mRNA, i.e., in the assembly of the 48S initiation complex (25, 43). This recruitment depends on the helicase activity of eIF4A to unwind secondary structure content in the 5' UTR of the mRNA. A subpopulation of eIF4A operates in the context of heterotrimeric eIF4F (which also contains eIF4E, a cap-binding protein, and eIF4G, a scaffolding protein that acts as a coordinating factor). eIF4B directly stimulates eIF4A helicase activity, while PABP stimulates eIF4A-dependent initiation by interacting with eIF4G (25, 43).

Our UV cross-linking data indicate that binding of eIFs 4A and 4B to BC1 RNA is mutually reinforcing (Fig. 8). eIF4B is required for 48S complex formation on mRNAs with base pairing in their 5' UTRs, and it has been suggested that eIF4B may modulate translational efficiency of its target mRNAs, for instance, in response to external stimuli (18). The intracellular concentration of eIF4B has been estimated to be considerably lower than that of eIF4A (18, 48), and cellular eIF4B may thus serve as a strategically placed mediator of the BC1-eIF4A repression mechanism. In addition, because eIF4B is the downstream target of several signaling pathways (23, 42, 49, 59), it may provide a point of access for the modulation of BC1-driven, eIF4A-dependent translational repression.

View larger version (29K): [in this window] [in a new window]

FIG. 8. BC1 RNA targets eIF4A functionality. The recruitment of eIFs 4A and 4B to BC1 RNA is mutually synergistic. As a result of BC1-eIF4A interactions, the helicase activity of the factor is uncoupled from its ATPase activity. PABP binds to BC1 RNA concurrently with eIF4A (65, 66) and interacts with eIF4B (10). BC1-eIF4A interactions do not prevent eIF4A from binding to the central domain of eIF4G. PABP is shown interacting with the central A22 domain, eIF4A with the A-rich single-stranded region at the interface to the 3' terminal stem-loop, and eIF4B with the terminal stem-loop itself. Although speculative, this placement is compatible with the BC1-eIF4A-eIF4B cross-linking data (Fig. 5) (see Fig. S6 in the supplemental material) that suggest that eIF4B is recruited by eIF4A into cross-linking proximity of the A-rich eIF4A-interacting domain. Standard 48S complex formation is shown on the left (see also reference 26). Some initiation factors have been omitted for clarity. The shown BC1 secondary structure sketch is based on previous experimental work (55). The full secondary structure of BC1 RNA is shown in Fig. S10 in the supplemental material.

While BC1 RNA is able to bind to eIF4A and PABP simultaneously (65, 66), PABP does not directly impact BC1-mediated regulation of eIF4A catalytic activity. Also, in view of the results with polyadenylated and nonadenylated reporter mRNAs in HEK293 cells, translational repression by BC1 RNA through sequestration of PABP, while certainly possible (30, 65), would seem to contribute at most 20% to overall BC1 repression competence. These results are in agreement with previous in vitro data showing that PABP sequestration is not a principal determinant in the BC1-mediated repression of (i) 48S complex formation (66) and of (ii) protein synthesis in rabbit reticulocyte lysates (30). On the other hand, indirect interactions of PABP with BC1-bound eIF4A are not ruled out. For example, eIF4B has been shown to bind to PABP (10), and BC1-bound PABP may thus be in contact with eIF4A through eIF4B. At the same time, eIF4G continues to interact with BC1-engaging eIF4A. It is therefore possible that a translationally nonproductive complex containing eIF4A, eIF4B, PABP, and eIF4G is assembled on BC1 RNA (Fig. 8).

BC1 RNA and BC200 RNA. The genes encoding BC1 RNA and BC200 RNA have evolved independently from two different progenitors via separate phylogenetic routes (8, 63). Despite the fact that they are therefore not orthologs, early speculation raised the possibility that BC1 and BC200 RNAs may be functional analogs (63). The results presented here not only corroborate this speculation but show that the functional equivalence of both RNAs, i.e., in their interaction with eIF4A, is in fact remarkably close. Such equivalence strongly argues for convergent phylogenetic development. It appears that BC1 RNA and BC200 RNA have been independently recruited in the rodent and primate lineages, respectively, into equivalent functional roles as local translational repressors in neurons. We suggest that the need for local translational control and thus for local translational repressors increased with growing number and complexity of postsynaptic specializations during evolution of the central nervous system.

Although proteins function as translational repressors in neurons, the case has been made that genes encoding small npcRNAs evolve at a much higher rate than genes encoding proteins and that as a result, such RNAs are eminently suited to enhance an organism's capability to adapt to changing environments (8, 11). We posit that the BC1 and BC200 genes were independently selected because they both encode neuron-specific RNAs that (i) contain codes for their delivery to synapto-dendritic domains and (ii) specifically target eIF4A, uncoupling its helicase and ATPase activities. These capabilities were obviously important for their functional recruitment and subsequent retention in evolution. Once thus recruited, BC RNAs have become indispensable and have remained highly conserved in their respective lineages, i.e., for at least 55 million years in the case of BC1 RNA and for at least 35 million years in the case of BC200 RNA (8).

 
We thank A. Komar and W. Merrick for advice on helicase assays, M. Dattilo for HEK293 cells, T. Preiss for pOT.CAT plasmids, and members of the Hellen, Pestova, and Tiedge labs for advice and discussion. Statistical consultation was provided by J. Weedon (SUNY Brooklyn Scientific Computing Center).

This work was supported in part by National Institutes of Health grants AI51340 (C.U.T.H.), GM059660 (T.V.P.), and NS046769 (H.T.).

 
* Corresponding author. Mailing address: The Robert F. Furchgott Center for Neural and Behavioral Science, Department of Physiology and Pharmacology, State University of New York, Health Science Center at Brooklyn, 450 Clarkson Avenue, Brooklyn, NY 11203. Phone: (718) 270-1370. Fax: (718) 270-2241. E-mail: htiedge{at}downstate.edu

Published ahead of print on 3 March 2008.

Supplemental material for this article may be found at http://mcb.asm.org/.

Top ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES

 

1
1. Abramson, R. D., T. E. Dever, T. G. Lawson, B. K. Ray, R. E. Thach, and W. C. Merrick. 1987. The ATP-dependent interaction of eukaryotic initiation factors with mRNA. J. Biol. Chem. 262:3826-3832.[Abstract/Free Full Text]
2
2. Barciszewski, J., and V. A. Erdmann (ed.). 2003. Noncoding RNAs: molecular biology and molecular medicine. Landes Bioscience, Georgetown, TX.
3
3. Bassell, G. J., and J. L. Twiss. 2006. RNA exodus to Israel: RNA controlling function in the far reaches of the neuron. EMBO Rep. 7:31-35.[CrossRef][Medline]
4
4. Bleichert, F., and S. J. Baserga. 2007. The long unwinding road of RNA helicases. Mol. Cell 27:339-352.[CrossRef][Medline]
5
5. Bordeleau, M. E., R. Cencic, L. Lindqvist, M. Oberer, P. Northcote, G. Wagner, and J. Pelletier. 2006. RNA-mediated sequestration of the RNA helicase eIF4A by Pateamine A inhibits translation initiation. Chem. Biol. 13:1287-1295.[CrossRef][Medline]
6
6. Brosius, J. 1989. Superpolylinkers in cloning and expression vectors. DNA 8:759-777.[Medline]
7
7. Brosius, J. 2005. Waste not, want not—transcript excess in multicellular eukaryotes. Trends Genet. 21:287-288.[CrossRef][Medline]
8
8. Brosius, J., and H. Tiedge. 1995. Reverse transcriptase: mediator of genomic plasticity. Virus Genes 11:163-179.[CrossRef][Medline]
9
9. Brosius, J., and H. Tiedge. 2004. RNomenclature. RNA Biol. 1:81-83.[Medline]
10
10. Bushell, M., W. Wood, G. Carpenter, V. M. Pain, S. J. Morley, and M. J. Clemens. 2001. Disruption of the interaction of mammalian protein synthesis eukaryotic initiation factor 4B with the poly(A)-binding protein by caspase- and viral protease-mediated cleavages. J. Biol. Chem. 276:23922-23928.[Abstract/Free Full Text]
11
11. Cao, X., G. Yeo, A. R. Muotri, T. Kuwabara, and F. H. Gage. 2006. Noncoding RNAs in the mammalian central nervous system. Annu. Rev. Neurosci. 29:77-103.[CrossRef][Medline]
12
12. Cheng, Y., and W. H. Prusoff. 1973. Relationship between the inhibition constant (K1) and the concentration of inhibitor which causes 50 per cent inhibition (I50) of an enzymatic reaction. Biochem. Pharmacol. 22:3099-3108.[CrossRef][Medline]
13
13. Chicurel, M. E., D. M. Terrian, and H. Potter. 1993. mRNA at the synapse: analysis of a preparation enriched in hippocampal dendritic spines. J. Neurosci. 13:4054-4063.[Abstract]
14
14. Cordin, O., J. Banroques, N. K. Tanner, and P. Linder. 2006. The DEAD-box protein family of RNA helicases. Gene 367:17-37.[CrossRef][Medline]
15
15. Cordin, O., N. K. Tanner, M. Doere, P. Linder, and J. Banroques. 2004. The newly discovered Q motif of DEAD-box RNA helicases regulates RNA-binding and helicase activity. EMBO J. 23:2478-2487.[CrossRef][Medline]
16
16. DeBlasi, A., K. O'Reilly, and H. J. Motulsky. 1989. Calculating receptor number from binding experiments using same compound as radioligand and competitor. Trends Pharmacol. Sci. 10:227-229.[CrossRef][Medline]
17
17. DeChiara, T. M., and J. Brosius. 1987. Neural BC1 RNA: cDNA clones reveal nonrepetitive sequence content. Proc. Natl. Acad. Sci. USA 84:2624-2628.[Abstract/Free Full Text]
18
18. Dmitriev, S. E., I. M. Terenin, Y. E. Dunaevsky, W. C. Merrick, and I. N. Shatsky. 2003. Assembly of 48S translation initiation complexes from purified components with mRNAs that have some base pairing within their 5' untranslated regions. Mol. Cell. Biol. 23:8925-8933.[Abstract/Free Full Text]
19
19. Görlach, M., C. G. Burd, and G. Dreyfuss. 1994. The mRNA poly(A)-binding protein: localization, abundance, and RNA-binding specificity. Exp. Cell Res. 211:400-407.[CrossRef][Medline]
20
20. Gray, N. K., and M. W. Hentze. 1994. Regulation of protein synthesis by mRNA structure. Mol. Biol. Rep. 19:195-200.[CrossRef][Medline]
21
21. Grifo, J. A., R. D. Abramson, C. A. Satler, and W. C. Merrick. 1984. RNA-stimulated ATPase activity of eukaryotic initiation factors. J. Biol. Chem. 259:8648-8654.[Abstract/Free Full Text]
22
22. Henn, A., W. Cao, D. Hackney, and E. M. De La Cruz. 2008. The ATPase cycle mechanism of the DEAD-box rRNA helicase, DbpA. J. Mol. Biol. 377:193-205.[CrossRef][Medline]
23
23. Holz, M. K., B. A. Ballif, S. P. Gygi, and J. Blenis. 2005. mTOR and S6K1 mediate assembly of the translation preinitiation complex through dynamic protein interchange and ordered phosphorylation events. Cell 123:569-580.[CrossRef][Medline]
24
24. Job, C., and J. Eberwine. 2001. Localization and translation of mRNA in dendrites and axons. Nat. Rev. Neurosci. 2:889-898.[CrossRef][Medline]
25
25. Kapp, L. D., and J. R. Lorsch. 2004. The molecular mechanics of eukaryotic translation. Annu. Rev. Biochem. 73:657-704.[CrossRef][Medline]
26
26. Kindler, S., H. Wang, D. Richter, and H. Tiedge. 2005. RNA transport and local control of translation. Annu. Rev. Cell Dev. Biol. 21:223-245.[CrossRef][Medline]
27
27. Klann, E., and J. D. Richter. 2007. Translational control of synaptic plasticity and learning and memory, p. 485-506. In M. B. Mathews, N. Sonenberg, and J. W. B. Hershey (ed.), Translational control in biology and medicine. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY.
28
28. Kolupaeva, V. G., S. de Breyne, T. V. Pestova, and C. U. Hellen. 2007. In vitro reconstitution and biochemical characterization of translation initiation by internal ribosomal entry. Methods Enzymol. 430:409-439.[CrossRef][Medline]
29
29. Kolupaeva, V. G., T. V. Pestova, C. U. Hellen, and I. N. Shatsky. 1998. Translation eukaryotic initiation factor 4G recognizes a specific structural element within the internal ribosome entry site of encephalomyocarditis virus RNA. J. Biol. Chem. 273:18599-18604.[Abstract/Free Full Text]
30
30. Kondrashov, A. V., M. Kiefmann, K. Ebnet, T. Khanam, R. S. Muddashetty, and J. Brosius. 2005. Inhibitory effect of naked neural BC1 RNA or BC200 RNA on eukaryotic in vitro translation systems is reversed by poly(A)-binding protein (PABP). J. Mol. Biol. 353:88-103.[CrossRef][Medline]
31
31. Korneeva, N. L., E. A. First, C. A. Benoit, and R. E. Rhoads. 2005. Interaction between the NH₂-terminal domain of eIF4A and the central domain of eIF4G modulates RNA-stimulated ATPase activity. J. Biol. Chem. 280:1872-1881.[Abstract/Free Full Text]
32
32. Lomakin, I. B., C. U. Hellen, and T. V. Pestova. 2000. Physical association of eukaryotic initiation factor 4G (eIF4G) with eIF4A strongly enhances binding of eIF4G to the internal ribosomal entry site of encephalomyocarditis virus and is required for internal initiation of translation. Mol. Cell. Biol. 20:6019-6029.[Abstract/Free Full Text]
33
33. Lorsch, J. R., and D. Herschlag. 1998. The DEAD box protein eIF4A. 1. A minimal kinetic and thermodynamic framework reveals coupled binding of RNA and nucleotide. Biochemistry 37:2180-2193.[CrossRef][Medline]
34
34. Low, W. K., Y. Dang, T. Schneider-Poetsch, Z. Shi, N. S. Choi, W. C. Merrick, D. Romo, and J. O. Liu. 2005. Inhibition of eukaryotic translation initiation by the marine natural product pateamine A. Mol. Cell 20:709-722.[CrossRef][Medline]
35
35. Motulsky, H., and A. Christopoulos. 2004. Fitting models to biological data using linear and nonlinear regression: a practical guide to curve fitting. Oxford University Press, New York, NY.
36
36. Muddashetty, R., T. Khanam, A. Kondrashov, M. Bundman, A. Iacoangeli, J. Kremerskothen, K. Duning, A. Barnekow, A. Hüttenhofer, H. Tiedge, and J. Brosius. 2002. Poly(A)-binding protein is associated with neuronal BC1 and BC200 ribonucleoprotein particles. J. Mol. Biol. 321:433-445.[CrossRef][Medline]
37
37. Munson, P. J., and D. Rodbard. 1988. An exact correction to the "Cheng-Prusoff" correction. J. Recept. Res. 8:533-546.[Medline]
38
38. Muslimov, I. A., A. Iacoangeli, J. Brosius, and H. Tiedge. 2006. Spatial codes in dendritic BC1 RNA. J. Cell Biol. 175:427-439.[Abstract/Free Full Text]
39
39. Muslimov, I. A., E. Santi, P. Homel, S. Perini, D. Higgins, and H. Tiedge. 1997. RNA transport in dendrites: a cis-acting targeting element is contained within neuronal BC1 RNA. J. Neurosci. 17:4722-4733.[Abstract/Free Full Text]
40
40. Oguro, A., T. Ohtsu, Y. V. Svitkin, N. Sonenberg, and Y. Nakamura. 2003. RNA aptamers to initiation factor 4A helicase hinder cap-dependent translation by blocking ATP hydrolysis. RNA 9:394-407.[Abstract/Free Full Text]
41
41. Pause, A., and N. Sonenberg. 1992. Mutational analysis of a DEAD box RNA helicase: the mammalian translation initiation factor eIF-4A. EMBO J. 11:2643-2654.[Medline]
42
42. Peng, C., A. Knebel, N. A. Morrice, X. Li, K. Barringer, J. Li, S. Jakes, B. Werneburg, and L. Wang. 2007. Pim kinase substrate identification and specificity. J. Biochem. 141:353-362.[Abstract/Free Full Text]
43
43. Pestova, T., J. R. Lorsch, and C. U. T. Hellen. 2007. The mechanism of translation initiation in eukaryotes, p. 87-128. In M. B. Mathews, N. Sonenberg, and J. W. B. Hershey (ed.), Translational control in biology and medicine. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY.
44
44. Pestova, T. V., C. U. Hellen, and I. N. Shatsky. 1996. Canonical eukaryotic initiation factors determine initiation of translation by internal ribosomal entry. Mol. Cell. Biol. 16:6859-6869.[Abstract]
45
45. Pestova, T. V., I. N. Shatsky, and C. U. Hellen. 1996. Functional dissection of eukaryotic initiation factor 4F: the 4A subunit and the central domain of the 4G subunit are sufficient to mediate internal entry of 43S preinitiation complexes. Mol. Cell. Biol. 16:6870-6878.[Abstract]
46
46. Pisarev, A. V., V. G. Kolupaeva, V. P. Pisareva, W. C. Merrick, C. U. Hellen, and T. V. Pestova. 2006. Specific functional interactions of nucleotides at key –3 and +4 positions flanking the initiation codon with components of the mammalian 48S translation initiation complex. Genes Dev. 20:624-636.[Abstract/Free Full Text]
47
47. Preiss, T., and M. W. Hentze. 1998. Dual function of the messenger RNA cap structure in poly(A)-tail-promoted translation in yeast. Nature 392:516-520.[CrossRef][Medline]
48
48. Rau, M., T. Ohlmann, S. J. Morley, and V. M. Pain. 1996. A reevaluation of the cap-binding protein, eIF4E, as a rate-limiting factor for initiation of translation in reticulocyte lysate. J. Biol. Chem. 271:8983-8990.[Abstract/Free Full Text]
49
49. Raught, B., F. Peiretti, A. C. Gingras, M. Livingstone, D. Shahbazian, G. L. Mayeur, R. D. Polakiewicz, N. Sonenberg, and J. W. Hershey. 2004. Phosphorylation of eucaryotic translation initiation factor 4B Ser422 is modulated by S6 kinases. EMBO J. 23:1761-1769.[CrossRef][Medline]
50
50. Ray, B. K., T. G. Lawson, J. C. Kramer, M. H. Cladaras, J. A. Grifo, R. D. Abramson, W. C. Merrick, and R. E. Thach. 1985. ATP-dependent unwinding of messenger RNA structure by eukaryotic initiation factors. J. Biol. Chem. 260:7651-7658.[Abstract/Free Full Text]
51
51. Richter, D. (ed.). 2001. Cell polarity and subcellular RNA localization. Springer, Berlin, Germany.
52
52. Rocak, S., and P. Linder. 2004. DEAD-box proteins: the driving forces behind RNA metabolism. Nat. Rev. Mol. Cell Biol. 5:232-241.[CrossRef][Medline]
53
53. Rogers, G. W., Jr., N. J. Richter, W. F. Lima, and W. C. Merrick. 2001. Modulation of the helicase activity of eIF4A by eIF4B, eIF4H, and eIF4F. J. Biol. Chem. 276:30914-30922.[Abstract/Free Full Text]
54
54. Rogers, G. W., Jr., N. J. Richter, and W. C. Merrick. 1999. Biochemical and kinetic characterization of the RNA helicase activity of eukaryotic initiation factor 4A. J. Biol. Chem. 274:12236-12244.[Abstract/Free Full Text]
55
55. Rozhdestvensky, T. S., A. M. Kopylov, J. Brosius, and A. Huttenhofer. 2001. Neuronal BC1 RNA structure: evolutionary conversion of a tRNA^Ala domain into an extended stem-loop structure. RNA 7:722-730.[Abstract]
56
56. Sambrook, J., and D. W. Russell. 2001. Molecular cloning: a laboratory manual, 3rd ed. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY.
57
57. Schwer, B., and T. Meszaros. 2000. RNA helicase dynamics in pre-mRNA splicing. EMBO J. 19:6582-6591.[CrossRef][Medline]
58
58. Sengoku, T., O. Nureki, A. Nakamura, S. Kobayashi, and S. Yokoyama. 2006. Structural basis for RNA unwinding by the DEAD-box protein Drosophila Vasa. Cell 125:287-300.[CrossRef][Medline]
59
59. Shahbazian, D., P. P. Roux, V. Mieulet, M. S. Cohen, B. Raught, J. Taunton, J. W. Hershey, J. Blenis, M. Pende, and N. Sonenberg. 2006. The mTOR/PI3K and MAPK pathways converge on eIF4B to control its phosphorylation and activity. EMBO J. 25:2781-2791.[CrossRef][Medline]
60
60. Steward, O., and E. M. Schuman. 2003. Compartmentalized synthesis and degradation of proteins in neurons. Neuron 40:347-359.[CrossRef][Medline]
61
61. Svitkin, Y. V., A. Pause, A. Haghighat, S. Pyronnet, G. Witherell, G. J. Belsham, and N. Sonenberg. 2001. The requirement for eukaryotic initiation factor 4A (elF4A) in translation is in direct proportion to the degree of mRNA 5' secondary structure. RNA 7:382-394.[Abstract]
62
62. Tiedge, H., and J. Brosius. 1996. Translational machinery in dendrites of hippocampal neurons in culture. J. Neurosci. 16:7171-7181.[Abstract/Free Full Text]
63
63. Tiedge, H., W. Chen, and J. Brosius. 1993. Primary structure, neural-specific expression, and dendritic location of human BC200 RNA. J. Neurosci. 13:2382-2390.[Abstract]
64
64. Tiedge, H., R. T. Fremeau, Jr., P. H. Weinstock, O. Arancio, and J. Brosius. 1991. Dendritic location of neural BC1 RNA. Proc. Natl. Acad. Sci. USA 88:2093-2097.[Abstract/Free Full Text]
65
65. Wang, H., A. Iacoangeli, D. Lin, K. Williams, R. B. Denman, C. U. T. Hellen, and H. Tiedge. 2005. Dendritic BC1 RNA in translational control mechanisms. J. Cell Biol. 171:811-821.[Abstract/Free Full Text]
66
66. Wang, H., A. Iacoangeli, S. Popp, I. A. Muslimov, H. Imataka, N. Sonenberg, I. B. Lomakin, and H. Tiedge. 2002. Dendritic BC1 RNA: functional role in regulation of translation initiation. J. Neurosci. 22:10232-10241.[Abstract/Free Full Text]
67
67. Wells, D. G., J. D. Richter, and J. R. Fallon. 2000. Molecular mechanisms for activity-regulated protein synthesis in the synapto-dendritic compartment. Curr. Opin. Neurobiol. 10:132-137.[CrossRef][Medline]
68
68. West, N., A. Roy-Engel, H. Imataka, N. Sonenberg, and P. Deininger. 2002. Shared protein components of SINE RNPs. J. Mol. Biol. 321:423-432.[CrossRef][Medline]

---

Molecular and Cellular Biology, May 2008, p. 3008-3019, Vol. 28, No. 9
0270-7306/08/$08.00+0     doi:10.1128/MCB.01800-07
Copyright © 2008, American Society for Microbiology. All Rights Reserved.

This Article Abstract Full Text (PDF) Supplemental material Alert me when this article is cited Alert me if a correction is posted Services Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Reprints and Permissions Copyright Information Books from ASM Press MicrobeWorld Citing Articles Citing Articles via Google Scholar Google Scholar Articles by Lin, D. Articles by Tiedge, H. Search for Related Content PubMed PubMed Citation Articles by Lin, D. Articles by Tiedge, H.