This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Supplemental material
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Sha, Y.
Right arrow Articles by Eissa, N. T.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Sha, Y.
Right arrow Articles by Eissa, N. T.

 Previous Article  |  Next Article 

Molecular and Cellular Biology, January 2009, p. 116-128, Vol. 29, No. 1
0270-7306/09/$08.00+0     doi:10.1128/MCB.00829-08
Copyright © 2009, American Society for Microbiology. All Rights Reserved.

A Critical Role for CHIP in the Aggresome Pathway {triangledown} ,{dagger}

Youbao Sha, Lavannya Pandit, Shenyan Zeng, and N. Tony Eissa*

Department of Medicine, Baylor College of Medicine, Houston, Texas 77030

Received 22 May 2008/ Returned for modification 21 July 2008/ Accepted 17 October 2008


arrow
ABSTRACT
 
Recent evidence suggests that aggresome formation is a physiologic stress response not limited to misfolded proteins. That stress response, termed "physiologic aggresome," is exemplified by aggresome formation of inducible nitric oxide synthase (iNOS), an important host defense protein. CHIP (carboxy terminus of Hsp70-interacting protein) is a highly conserved protein that has been shown to mediate substrate ubiquitination and degradation by the proteasome. In this study, we show that CHIP has a previously unexpected critical role in the aggresome pathway. CHIP interacts with iNOS and promotes its ubiquitination and degradation by the proteasome as well as its sequestration to the aggresome. CHIP-mediated iNOS targeting to the proteasome sequentially precedes CHIP-mediated iNOS sequestration to the aggresome. CHIP is required for iNOS preaggresome structures to form a mature aggresome. Furthermore, CHIP is required for targeting the mutant form of cystic fibrosis transconductance regulator (CFTR{Delta}F508) to the aggresome. Importantly, the ubiquitin ligase function of CHIP is required in targeting preaggresomal structures to the aggresome by promoting an iNOS interaction with histone deacetylase 6, which serves as an adaptor between ubiquitinated proteins and the dynein motor. This study reveals a critical role for CHIP in the aggresome pathway.


arrow
INTRODUCTION
 
Misfolding and aggregation of proteins play an important part in the pathogenesis of several genetic and degenerative diseases. Understanding the cellular processes responsible for the triage of misfolded proteins is critical for elucidating the pathophysiology of many diseases associated with misfolded proteins. Cells utilize a vast array of chaperones that help in refolding proteins. Proteins that are not amenable to the chaperone refolding pathway are targeted for degradation by the ubiquitin proteasome pathway. Cells have a third pathway that involves sequestration of aggregated misfolded proteins, such as the mutant form of the cystic fibrosis transmembrane conductance regulator (CFTR{Delta}F508), into specialized "holding stations" called aggresomes (14). The aggresome is typically formed in the cell at a perinculear location near the microtubular organizing center (MTOC) and the centrosome. Aberrant folding and defective trafficking of CFTR{Delta}F508 are the principal causes of cystic fibrosis. Recent evidence suggests that aggresome formation is also a physiologic mechanism to regulate certain cellular proteins (16). This process, termed "physiologic aggresome," is exemplified by cellular regulation of inducible nitric oxide synthase (iNOS). Although it is clear that proteasomal inhibition results in acceleration of the aggresome pathway, the molecular effectors involved in targeting proteins to aggresome sequestration are not well studied.

CHIP (carboxy terminus of Hsp70-interacting protein) is a highly conserved protein that has a tetratricopeptide repeat (TPR) domain at its amino terminus and a U-box domain at its carboxy terminus (3). CHIP interacts with the molecular chaperones Hsc70-Hsp70 and Hsp90 through its TPR domain, whereas its U-box domain contains its E3 ubiquitin ligase activity. Through its interaction with molecular chaperones, CHIP has been shown to mediate client substrate ubiquitination and degradation by the proteasome (6, 12, 20). The combination of chaperone binding and ubiquitin ligase activity suggests a multifaceted role for CHIP in facilitating the switch from chaperone-mediated folding/maturation to proteasome-mediated degradation via ubiquitination (19). Such a role for CHIP has been demonstrated for several client substrates including CFTR{Delta}F508, polyglutamine-expanded huntingtin, ataxin-1, and ataxin-3 (2, 12, 20). CHIP was also found to inactivate endothelial NOS by displacing it from the Golgi apparatus to a detergent-insoluble fraction (13). A recent study demonstrated that deletion of CHIP resulted in a decrease in aggregation of tau protein (7). Whether or not CHIP has a role in aggresome formation remains unknown.

iNOS, an important host defense protein, is responsible for nitric oxide (NO) synthesis in response to cytokines and inflammatory mediators (8). iNOS has been shown to be regulated by chaperones (24), by the ubiquitin proteasome pathway (18, 21), and by aggresome formation (16). Therefore, iNOS regulation constituted an ideal model to study the cellular triage decisions between these various protein quality control pathways. We show that CHIP interacted with iNOS and promoted its ubiquitination and degradation by the proteasome. More importantly, this study reveals a previously unrecognized role for CHIP in promoting aggresome formation. CHIP promoted iNOS sequestration to the aggresome. CHIP-mediated iNOS targeting to the proteasome preceded CHIP-mediated iNOS sequestration to the aggresome. Furthermore, we show that CHIP itself colocalized with iNOS in the aggresome and that knockdown of CHIP resulted in failure of iNOS preaggresome structures to be targeted to the perinuclear mature aggresome. In addition to its interaction with iNOS, CHIP colocalized with the CFTR{Delta}F508 aggresome and was required for targeting CFTR{Delta}F508 to the aggresome. Importantly, the ubiquitin ligase function of CHIP is required in targeting preaggresomal structures to the aggresome by promoting iNOS interaction with histone deacetylase 6 (HDAC6). The latter serves as an adaptor between ubiquitinated proteins and the dynein motor. This study reveals a critical role for CHIP in the aggresome pathway.


arrow
MATERIALS AND METHODS
 
Reagents and antibodies. N-Carbobenzoxyl-L-leucinyl-L-leucinyl-L-norleucinal (MG132), N-ethylmaleimide (NEM), and Triton X-100 were from Sigma. Tween 20 and prestained molecular mass standards were from Bio-Rad. Protein A-Sepharose beads were from GE Healthcare Biosciences. Monoclonal iNOS antibody 1E8-B8 (used for Western blotting) was from Research and Diagnostic Antibodies (Benicia, CA), and polyclonal iNOS antibody 06-573 (used for immunoprecipitation) was from Upstate Biotechnology (Lake Placid, NY). Ubiquitin antibody U5379 was from Sigma. PA1-015 is a polyclonal antibody (ABR-Affinity BioReagents, Golden, CO) against CHIP. I{kappa}B-β (C-20) and {gamma}-tubulin antibodies were from Santa Cruz (Santa Cruz, CA). BMG-His-1 is a monoclonal anti-His6 antibody from Roche. V9 and GTU-88 are monoclonal anti-vimentin and anti-{gamma}-tubulin antibodies from Sigma. 6C5 (Advanced ImmunoChemical, Long Beach, CA) is a monoclonal antibody against glyceraldehyde-3-phosphate dehydrogenase (GAPDH). Polyclonal giantin antibody was from CPR (Berkeley, CA). Polyclonal calreticulin antibody was from Abcam (Cambridge, MA). Monoclonal anti-human CD107{alpha} (Lamp1) was from BD Biosciences (Franklin Lakes, NJ). Erythro-9[3-(2-hydroxynonyl)] adenine (EHNA) was from Sigma. Nocodazole was from Calbiochem (Gibbstown, NJ). Antibodies against {alpha}-tubulin (B-5-1-2) and acetylated {alpha}-tubulin (6-11B-1) were from Abcam (Cambridge, MA). HDAC6 antibody (H-300) was from Santa Cruz (CA).

Cell culture. HEK293 cells were cultured in improved minimal essential medium Mediatech, Herndon, VA), and human bladder transitional cell papilloma (RT4) cells were cultured in McCoy's medium (Mediatech). Each medium was supplemented with 2 mM glutamine, 1x antibiotic-antimycotic cocktail, and 10% heat-inactivated fetal bovine serum (Invitrogen). All cells were maintained at 37°C in 5% CO2.

Normal primary human bronchial epithelial cells (Lonza) were cultured in bronchial epithelial cell growth medium (Lonza) containing 130 ng/ml bovine pituitary extract, 5 x 10–5 mM retinoic acid, 1.5 µg/ml bovine serum albumin, 20 IU/ml nystatin, 0.5 mg/ml hydrocortisone, 25 ng/ml human epithelial growth factor, 0.5 µg/ml epinephrine, 10 µg/ml transferrin, 5 µg/ml insulin, 6.5 ng/ml triiodothyronine, and 50 µg/ml gentamicin. Passage 2 cells were cultured at the air-liquid interface onto semipermeable membrane inserts (Transwell-Clear; Corning) in a serum-free, 1:1 mixture of Dulbecco's modified Eagle's medium (Invitrogen) and bronchial epithelial cell growth medium supplemented as above except that 0.5 ng/ml human epithelial growth factor was used. The cultures were grown submerged until cells reached 70% confluence. Thereafter, culture medium was changed daily by replacing fresh medium only in the basal compartment. Cultures were maintained at 37°C in a humidified 5% CO2 atmosphere for a further 2 weeks after confluence until they reached a fully differentiated mucociliary plateau phase. For iNOS induction, differentiated normal primary human bronchial epithelial cells or RT4 cells were stimulated by a mixture of gamma interferon (100 units/ml), interleukin-1β (0.5 ng/ml), and tumor necrosis factor alpha (10 ng/ml).

Plasmids and transfections. Vectors encoding full-length iNOS cDNA or an iNOS-green fluorescent protein (GFP) fusion were previously described (16, 21). Full-length human CHIP was cloned by reverse transcription-PCR from cDNA of HEK293 cells and fused with a His tag or Flag tag in the pcDNA3.1 expression vector (Invitrogen). Plasmid vectors expressing CHIP with the mutation H260Q (CHIP-H260Q) or CHIP-K30A were kindly provided by Len Neckers. Vectors expressing CFTR{Delta}F508-GFP and p50 were gifts from Bruce Stanton and Li-Yuan Yu-Lee, respectively. Vector-based CHIP-specific small hairpin RNA (shRNA) encoding CCAACTTGGCTATGAAGGAGGTTATTGAC, vector-based HDAC6-specific shRNA encoding AGGTCTACTGTGGTCGTTACATCAATGGC, and a control vector-based shRNA encoding TGACCACCCTGACCTACGGCGTGCAGTGC were from Origene (Rockville, MD). Lentivirus vectors encoding CCAACTTGGCTATGAAGGAGGTTATTGAC and TGACCACCCTGACCTACGGCGTGCAGTGC were generated by America Pharma Source (Gaithersburg, MD). Cationic lipid-mediated transient transfection of plasmids was done using Lipofectamine 2000 (Invitrogen) into 70 to 80% confluent cells.

Cell lysis. Cells were rinsed twice with phosphate-buffered saline and lysed on ice for 30 min in the presence of a mix of protease inhibitors (17) in high stringency buffer A (40 mM bis-Tris propane, pH 7.7, 150 mM NaCl, 10% glycerol, and 1% Triton X-100) or in low stringency NETN buffer B (20 mM Tris-Cl, pH 8.0, 100 mM NaCl, 1 mM EDTA, and 0.5% NP-40). In some experiments, 5 mM NEM was added to cell lysis buffer to minimize deubiquitination of iNOS during cell lysis. Lysates were centrifuged (16,000 x g for 15 min at 4°C). The detergent (Triton X-100)-insoluble fraction was dissolved in 1% sodium dodecyl sulfate (SDS). Total protein concentrations were determined by using a bicinchoninic acid reagent, following the manufacturer's instructions (Pierce).

Immunoprecipitation. In experiments examining ubiquitination of iNOS, cells were lysed in buffer A, and 0.5 mg of cell lysates was incubated at 4°C with polyclonal anti-iNOS antibody in a total volume of 500 µl of lysis buffer for 120 min before protein A-Sepharose beads (50 µl of 10% solution) were added to the samples. After further incubation for 60 min at 4°C, beads were washed three times in ice-cold lysis buffer. Immunoprecipitated proteins were eluted by heating at 95°C for 5 min in Laemmli sample buffer (50 mM Tris-HCl, pH 6.8, 2% SDS, 0.001% bromophenol blue, 10% glycerol, 100 mM dithiothreitol). To investigate protein-protein interaction, cells were lysed in NETN buffer B, and 1 mg of cell lysates was precleared by incubation at 4°C with 20 µl of 10% protein A-Sepharose beads in a total volume of 1,000 µl of NETN buffer. Protein A-Sepharose beads were discarded after a 30-min incubation, and appropriate antibodies were added. After a 120-min incubation, 50 µl of 10% protein A-Sepharose beads was added to the samples. Samples were further incubated for 60 min at 4°C, and beads were washed three times in ice-cold lysis buffer. Immunoprecipitated proteins were eluted as above.

Western analysis. Cell lysate (50 µg) or immunoprecipitated proteins were heated at 95°C for 5 min in Laemmli sample buffer and resolved by SDS-polyacrylamide gel electrophoresis (PAGE) (Invitrogen). Proteins were transferred to nitrocellulose membranes by using a semidry transfer cell (Bio-Rad). Membranes were blocked with 5% nonfat milk for 1 h, followed by a 2-h incubation of primary antibody and 1-h incubation of secondary antibody. Immunoreactive bands were visualized with an enhanced chemiluminescence system (SuperSignal West Pico; Pierce). Images were acquired by a cooled, charge-coupled-device camera (Eagle Eye II Still Video System; Stratagene).

Pulse-chase analysis. Cells were pulsed with 0.25 mCi/ml 35S-labeled methionine-cysteine mixture for 1 h. Incorporation of radioactive methionine-cysteine was terminated by incubating cells in Dulbecco's modified Eagle's medium with excess unlabeled methionine and cysteine (300 mg/liter, each) before cells were harvested at various time points. Cell lysates were immunoprecipitated using anti-iNOS antibody and protein A-Sepharose. Eluted proteins were separated by SDS-PAGE. Gels were dried for 3 h. Gel bands representing 35S-labeled iNOS were quantitated using a phosphorimager (17).

Immunofluorescence and microscopy. Cells were grown on glass coverslips coated with poly-D-lysine, fixed in 4% paraformaldehyde, permeabilized by 0.2% Triton X-100, and blocked in 10% normal goat serum. Primary antibody incubation was done at room temperature for 1 h, followed by a 30-min incubation at room temperature with Alexa Fluor-labeled secondary antibodies (Molecular Probes, Eugene, OR). Coverslips were mounted by the blue nuclear chromatin stain 4',6'-diamidino-2-phenylindole (DAPI; Molecular Probes) and viewed by using a Zeiss Axiovert microscope deconvolution microscopy system. Imaging was performed by using a Zeiss 100x (1.4 numerical aperture) oil immersion lens, and Z sections were collected at an optical depth of 0.25 µm. Images were optimized by using Zeiss deconvolution software (16).


arrow
RESULTS AND DISCUSSION
 
Knockdown of endogenous CHIP increases iNOS steady-state level. We examined iNOS cellular expression following knockdown of endogenous CHIP using shRNA. We used HEK293 cells stably expressing iNOS and transitional bladder carcinoma RT4 cells that express endogenous iNOS upon cytokine induction. In both cell types, knockdown of CHIP led to an increase in the steady state of iNOS (Fig. 1). The increase in iNOS level was further confirmed by observing an increase in NO production, evaluated by measuring nitrite accumulation in culture medium. These data suggest that CHIP plays a role in promoting degradation of iNOS and that iNOS is a physiologic client for CHIP. Knockdown of CHIP had no effect on iNOS mRNA levels (see Fig. S1 in the supplemental material).


Figure 1
View larger version (35K):
[in this window]
[in a new window]

  		FIG. 1. Knockdown of endogenous CHIP increases iNOS cellular level. (A). HEK293 cells stably expressing iNOS were transfected for 72 h with a plasmid encoding either control shRNA having no perfect matches to any human gene or shRNA specific for CHIP. (B) RT4 cells were transduced with lentivirus encoding CHIP-specific shRNA or control shRNA. After 48 h, cells were incubated with gamma interferon (100 U/ml), interleukin-1β (0.5 ng/ml), and tumor necrosis factor alpha (10 ng/ml) for 24 h. In both panels, cells were lysed, and Western analysis was used to evaluate CHIP, iNOS, or GAPDH. iNOS activity was evaluated by measuring nitrite accumulation in the culture medium. Data represent mean ± standard deviation. n = 3 (A) or 4 (B). *, P < 0.05, compared to the control condition.

CHIP is required for iNOS aggresome formation. (i)Knockdown of CHIP prevents iNOS aggresome formation. To investigate the effect of CHIP knockdown on iNOS aggresome formation, we conducted imaging analysis of cells after knockdown of CHIP. HEK293 cells stably expressing iNOS-GFP were transfected for 72 h with plasmids expressing either control shRNA or shRNA specific for CHIP. Cells were then evaluated by fluorescence microscopy. Knockdown of CHIP caused a unique cellular phenotype (Fig. 2A). Cells without CHIP showed an increase in preaggresomal structures that could not form a mature aggresome at the MTOC. Preaggresomal structures, also described as protein aggregates, have been previously shown to precede aggresome formation at the MTOC (9). Homing of iNOS preaggresomal structures to the MTOC was also demonstrated in our study by live cell imaging (see Video S1 in the supplemental material). To further confirm that CHIP was required for mature aggresome formation, we studied cells with enhanced aggresome formation, accelerated by the proteasome inhibitor MG132. Addition of MG132 for 3 h resulted in mature aggresome formation in control cells. In contrast, cells lacking CHIP failed to form a mature aggresome (Fig. 2B; see also Fig. S2 in the supplemental material). Importantly, preaggresome structures did not colocalize with {gamma}-tubulin at the MTOC and did not associate with vimentin cage collapse (see Fig. S2 in the supplemental material). These two features are characteristic of mature aggresome formation (9, 14, 16).


Figure 2
View larger version (47K):
[in this window]
[in a new window]

  		FIG. 2. Critical role for CHIP in iNOS aggresome formation. (A and B) HEK293 cells stably expressing iNOS-GFP were transfected for 72 h with plasmids expressing either control shRNA or shRNA specific for CHIP. Cells were incubated for 3 h in the presence of vehicle only (DMSO) (A) or a 10 µM concentration of the proteasome inhibitor MG132 (B). Cells were then fixed, stained with DAPI to visualize the nuclei (blue), immunostained with CHIP antibody, and examined by fluorescence microscopy. Arrows in panel B point to the mature iNOS aggresome. Graphs show quantitation of the percentage of cells expressing iNOS aggresome or preaggresome structures. (C to E) HEK293 cells were cotransfected with a plasmid encoding cDNA of human iNOS-GFP and with a plasmid containing vector as a control or Flag-tagged CHIP. The molar ratio of the iNOS plasmid to the coplasmid was 1:10. At 24 (C) or 48 (D and E) h after transfection, cells were examined by fluorescence microscopy. Quantitation of the percentage of cells expressing the iNOS aggresome is shown (C and D). CHIP-transfected cells exhibited larger iNOS aggresomes (E). Data represent mean ± standard deviation (n = 3). *, P < 0.05; **, P < 0.001 (compared to control condition). Scale bar, 10 µm.

(ii) CHIP promotes iNOS aggresome formation. The above data led us to investigate the effect of CHIP overexpression on iNOS aggresome formation. We examined iNOS aggresome formation in HEK293 cells cotransfected with iNOS-GFP and CHIP. At 24 h after transfection, there was no significant difference in iNOS aggresome formation between cells transfected with CHIP or with a control vector (Fig. 2C). In contrast, when cells were evaluated at 48 h after transfection, there was a significant increase in the percentage of cells expressing the iNOS aggresome (Fig. 2D). In addition to the increase in the number of cells expressing the iNOS aggresome, there was a noticeable increase in the size of the iNOS aggresome in cells cotransfected with CHIP (Fig. 2E). To confirm that CHIP-induced iNOS aggresome is a bona fide aggresome, we conducted several characterization studies. Similar to what was previously described for aggresomes, the CHIP-induced iNOS aggresome was formed at the MTOC, surrounded the centrosome, was caged by vimentin, and was distinct from other perinuclear structures such as the Golgi apparatus, lysosomes, or the endoplasmic reticulum (see Fig. S3 in the supplemental material) (14, 16). Further, microtubule disruption using the microtubular depolymerizing agent nocodazole, prevented CHIP-induced iNOS aggresome formation (see below), indicating that aggresome formation was microtubuluar dependent.

The above results suggested that CHIP was required for homing of iNOS preaggresomal structures to the MTOC to form the mature aggresome. In the absence of CHIP, there was an increase in iNOS preaggresomal structures, probably secondary to the combination of an increase in the iNOS steady-state level, as shown in Fig. 1, and a failure to transport iNOS to the MTOC. Knockdown of CHIP produced a remarkable arrest in iNOS aggresome formation and resulted in accumulation of preaggresomal structures, whereas overexpression of CHIP promoted iNOS aggresome formation. Overall, these data provide a glimpse into the cellular aggresome maturation process.

CHIP is required for aggresome formation by CFTR{Delta}F508. The above data suggested that CHIP is required for iNOS aggresome formation, a prototype for a physiologic aggresome (16). We investigated whether CHIP might also be required for "pathological" aggresome formation caused by a misfolded protein such as CFTR{Delta}F508. As previously shown, CFTR{Delta}F508-GFP formed an aggresome in HEK293 cells (14). Interestingly, our data showed that CHIP colocalized with the CFTR{Delta}F508 aggresome (Fig. 3A). In striking parallel to the data shown above for the iNOS aggresome, knockdown of CHIP resulted in accumulation of CFTR{Delta}F508 preaggresomal structures that could not form a mature aggresome at the MTOC. As expected, proteasomal inhibition with MG132 accelerated CFTR{Delta}F508 aggresome formation. However, in cells deficient in CHIP, proteasomal inhibition failed to form a mature CFTR{Delta}508 aggresome (Fig. 3B; see also Fig. S4 in the supplemental material). These data strongly suggest that CHIP has a previously unrecognized critical role in iNOS and CFTR{Delta}508 aggresome formation and is required for homing of preaggresomal structures to the MTOC.


Figure 3
View larger version (35K):
[in this window]
[in a new window]

  		FIG. 3. Knockdown of CHIP prevents aggresome formation by CFTR{Delta}F508. HEK293 cells were transfected for 48 h with plasmids expressing either control shRNA or shRNA specific for CHIP. Cells were then transfected for 24 h with a plasmid expressing CFTR{Delta}F508-GFP. Cells were incubated for 6 h in the presence of vehicle only (DMSO) (A) or a 10 µM concentration of the proteasome inhibitor MG132 (B). Cells were then fixed, stained with DAPI to visualize the nuclei (blue), immunostained with CHIP antibody, and examined by fluorescence microscopy. Arrows point to the mature CFTR{Delta}F508 aggresome. Graphs show quantitation of the percentage of cells expressing CFTR{Delta}F508 aggresome or preaggresome structures. Data represent mean ± standard deviation (n = 2). *, P < 0.05, compared to control condition. Scale bar, 10 µm.

CHIP interacts with iNOS and promotes its ubiquitination: contributions of various domains of CHIP. The above studies showed that knockdown of CHIP resulted in an increase of iNOS steady-state levels and that CHIP is required for iNOS aggresome formation. We therefore investigated a potential interaction between iNOS and CHIP. Experiments were done utilizing vectors for CHIP and two functional mutants of CHIP (Fig. 4A). CHIP-K30A has a point mutation in the TPR chaperone-binding domain and therefore is unable to bind chaperones. CHIP-H260Q has a point mutation in the U-box domain of CHIP and therefore is deficient in E3 ubiquitin ligase activity (23). The expression levels of wild-type (WT) CHIP and CHIP mutants in HEK293 cells were similar (Fig. 4A, lower blot). HEK293 cells were then cotransfected for 24 h with iNOS and with either a control vector or vectors encoding CHIP fused to a six-His tag (His-CHIP), His-CHIP-H260Q, or His-CHIP-K30A. The molar ratio of the iNOS plasmid to the coplasmid was 1:1. Whereas cotransfection of CHIP-K30A had no significant effect on iNOS activity, CHIP-H260Q cotransfection dramatically reduced NO production by iNOS and to a greater extent than WT CHIP did (Fig. 4B).


Figure 4
View larger version (21K):
[in this window]
[in a new window]

  		FIG. 4. Contributions of the chaperone binding domain and ubiquitin ligase domain to CHIP's role in cellular triage of iNOS. (A) Diagram and domain organization of CHIP. TPR-containing domain mediating interaction with chaperones (violet) and E3 ubiquitin ligase domain (green; U-box) are highlighted. The mutation sites of the chaperone binding-deficient mutant CHIP-K30A and the ubiquitin ligase-deficient mutant CHIP-H260Q are shown. HEK293 cells were transfected for 24 h with WT CHIP or CHIP mutants. Cells were lysed, and Western analysis was carried out to evaluate CHIP or GAPDH using His-tagged antibody or GAPDH antibody, respectively. (B) CHIP-H260Q mutant inactivates iNOS. HEK293 cells were cotransfected for 24 h with a plasmid encoding cDNA of human iNOS and with a plasmid containing control vector, WT His-CHIP, the His-CHIP-H260Q mutant, or the His-CHIP-K30A mutant. The molar ratio of the iNOS plasmid to the coplasmid was 1:5. iNOS activity was evaluated by measuring nitrite accumulation in culture medium (mean ± standard deviation; n = 6). (C) CHIP-H260Q mutant exhibits avid interaction with iNOS. HEK293 cells were cotransfected as in panel B except that the molar ratio of the iNOS plasmid to the coplasmid was 1:1. Twenty-four hours after transfection, cells were incubated with a 10 µM concentration of the proteasome inhibitor MG132 for 6 h and then lysed in NETN buffer. Cell lysates were subjected to immunoprecipitation (IP) with iNOS antibody or with His-tagged antibody. An aliquot of the immunoprecipitate was subjected to Western blotting with iNOS antibody or with His-tagged antibody. Immunoprecipitation with I{kappa}B-β antibody was used as a negative control. Western analysis (lower panel) was done on cell lysates prior to immunoprecipitation. Protein loading was done in equal aliquots corresponding to 2.5% of the amount of proteins used for immunoprecipitation. (D) CHIP-H260Q mutant does not ubiquitinate iNOS. HEK293 cells were cotransfected as in panel B. At 24 h posttransfection, cells were incubated with 10 µM MG132 for 3 h and then lysed. Cell lysates were subjected to immunoprecipitation (IP) with an iNOS antibody. An aliquot of the immunoprecipitate was subjected to Western blotting (W) with ubiquitin (Ub) antibody. (E and F) HEK293 cells were cotransfected as in panel B. At 24 (E) or 48 (F) h after transfection, cells were lysed using 1% Triton X-100 as a detergent, and lysates were divided into Triton X-100-soluble (S) and Triton X-100-insoluble (IS) fractions. Equal aliquots of cell lysates (50 µg) were evaluated by Western blotting using antibodies against iNOS, CHIP, or GAPDH. *, P < 0.05; **, P < 0.001.

To determine the underlying mechanisms for these observations, using cotransfection experiments, we examined the interactions between iNOS and either WT CHIP or each of the CHIP mutants. To minimize the impact of potential accelerated iNOS degradation induced by CHIP, the proteasome inhibitor MG132 was added to cell culture for 6 h before cells were lysed. We used immunoprecipitation to pull down either iNOS or CHIP from cell lysates. Immunoprecipitation with I{kappa}B-β antibody was used as a negative control. When iNOS was immunoprecipitated from cell lysates, WT CHIP or the CHIP-H260Q mutant but not the CHIP-K30A mutant was coprecipitated (Fig. 4C). Similarly, when WT CHIP or CHIP-H260Q but not CHIP-K30A was immunoprecipitated, iNOS was coprecipitated. These data suggested that CHIP-K30A either did not interact with iNOS or that the interaction was weak and could not be detected. Thus, the chaperone binding activity of CHIP is important for the interaction of CHIP with iNOS. CHIP-K30A had a dramatically reduced affinity to HSP70 (Fig. 4C) and overexpression of WT CHIP or of either of the CHIP mutants (CHIP-H26Q or CHIP-K30A) did not, per se, affect the interaction of iNOS with HSP70 (Fig. 4C). Interestingly, the CHIP-H260Q mutant exhibited a stronger interaction with iNOS than WT CHIP. When iNOS was immunoprecipitated, CHIP-H260Q was more abundantly coprecipitated with iNOS than WT CHIP. This increased coprecipitation of iNOS occurred in spite of the CHIP-H260Q-induced reduction in iNOS level in the detergent-soluble fraction of cell lysates used for immunoprecipitation. In reciprocal experiments, when CHIP or CHIP mutants were immunoprecipitated, iNOS most abundantly coprecipitated with CHIP-H260Q. These data suggest that, in the absence of the ubiquitin ligase activity of CHIP, its interaction with iNOS either became stronger or lasted longer. Thus, the results imply that ubiquitination of the substrate by CHIP might be required for termination of the interaction between CHIP and the substrate.

We then examined iNOS ubiquitination in cells cotransfected for 24 h with iNOS and with either WT CHIP, CHIP-H260Q, CHIP-K30A, or a control vector. The proteasome inhibitor MG132 was added to cell culture for 3 h before lysis. iNOS was then immunoprecipitated from cell lysates, and the immunoprecipitates were evaluated for the presence of ubiquitinated iNOS (Fig. 4D). Ubiquitinated iNOS was increased with the coexpression of CHIP, suggesting that CHIP promoted iNOS ubiquitination. Ubiquitinated iNOS was reduced in cells transfected with CHIP-H260Q. However, this reduction could be partially caused by the corresponding reduction of steady-state level of iNOS in these cells. Surprisingly, CHIP-K30A increased iNOS ubiquitination, albeit to a much less extent than WT CHIP. The increased ubiquitination of a substrate in the presence of the CHIP-K30A mutant has been previously reported but not fully explained (23). It is likely to be due a direct weak interaction between CHIP-K30A and its substrate, indicating that CHIP can have a direct chaperone-independent albeit weak interaction with some substrates, as recently suggested (22).

CHIP promotes iNOS sequestration to a detergent-resistant fraction. Because CHIP-H260Q could not ubiquitinate iNOS but still reduced iNOS in immunoprecipitation of detergent-soluble fraction of cell lysates (Fig. 4C), we hypothesized that CHIP-H260Q targeted iNOS to a detergent-resistant cellular fraction. We examined the effect of exogenous expression of CHIP mutants on iNOS levels in both detergent-soluble and insoluble fractions. We performed cotransfection experiments in HEK293 cells using iNOS cDNA combined with either that of CHIP, CHIP mutants, or a control vector. Cells were lysed 24 h or 48 h posttransfection using 1% Triton X-100 detergent-based buffer. Because aggresomes are partially Triton X-100 insoluble (11), lysates were divided into detergent-soluble and detergent-insoluble fractions. Western analysis of cell lysates revealed that reduction of iNOS steady-state levels by CHIP occurred in the detergent-soluble fraction (Fig. 4E). In contrast, CHIP caused an increase in iNOS in the detergent-resistant fraction, detected to a greater extent at 48 h posttransfection (Fig. 4F).

At 24 h posttransfection, the predominant effect of CHIP was to cause a reduction in iNOS in the detergent-soluble fraction, whereas at 48 h CHIP mainly caused an increase in iNOS in the detergent-resistant fraction. These data suggested that CHIP had two effects on iNOS. Initially, the main effect of CHIP seemed to be reduction of iNOS steady-state levels, possibly by targeting iNOS to proteasomal degradation. This early phase was followed by a later phase in which the main effect of CHIP was the sequestration of iNOS to a detergent-resistant fraction, possibly the aggresome. The CHIP-K30A mutant had no marked effect on iNOS steady-state levels (Fig. 4E and F). In contrast, the CHIP-H260Q mutant led to marked sequestration of iNOS to a detergent-resistant fraction. This effect was more pronounced than that of WT CHIP and could be detected earlier, at 24 h posttransfection. These data suggested that CHIP-H260Q has a dominant-negative effect on endogenous CHIP. It should be noted that although preaggresomes are distinct morphologically from mature aggresomes, both structures are detergent resistant. Thus, biochemical detection of iNOS in the detergent-resistant fraction cannot distinguish between iNOS in preaggresomes or in mature aggresomes.

CHIP promotes iNOS degradation by the proteasome. The above data demonstrated that CHIP interacted with iNOS and promoted its ubiquitination and that CHIP transfection led to an initial reduction of the iNOS level in the detergent-soluble fraction, followed by a later prominent increase in iNOS in the detergent-resistant fraction. To determine if the initial reduction of iNOS by CHIP was caused by targeting iNOS to proteasomal degradation, we studied the effects of CHIP on the iNOS half-life in the presence or absence of proteasomal inhibitors. The half-life of iNOS, measured by pulse-chase analysis in cells cotransfected with CHIP, was significantly shorter than that of iNOS cotransfected with a control vector (1.2 ± 0.6 h versus 2.7 ± 0.2 h, respectively) (Fig. 5A) (P < 0.05). It should be noted that because cells have to be labeled for 1 h to generate a strong, labeled iNOS signal and because the iNOS half-life is relatively short, some degradation occurs during the labeling period. Evidence of enhanced degradation of iNOS by CHIP during the labeling period can be deduced from the reduction of the iNOS level in cells cotransfected with CHIP at the 0-h time point (Fig. 5). However, this phenomenon has no effect on the iNOS half-life calculation because the 0-h time point is used as a reference of 100% value. Parallel experiments were performed in the presence of the proteasome inhibitor MG132. As previously shown, proteasomal inhibition prolonged the iNOS half-life but did not completely block iNOS decay (Fig. 5B) (17). Nevertheless, proteasomal inhibition was able to rescue most but not all of the iNOS half-life reduction induced by CHIP. Because the aggresome is partially detergent resistant and thus is not readily available for the immunoprecipitation used in the half-life determination (11), some of the apparent half-life decay is due to aggresome sequestration that could not be rescued by proteasomal inhibition.


Figure 5
View larger version (29K):
[in this window]
[in a new window]

  		FIG. 5. CHIP promotes iNOS proteasomal degradation. HEK293 cells were cotransfected with human iNOS cDNA and with either a control vector or with CHIP in a 1:5 molar ratio. At 24 h posttransfection, cells were pulsed with [35S]methionine-cysteine for 1 h and chased with unlabeled medium at various time points in the absence (A) or the presence (B) of a 10 µM concentration of the proteasome inhibitor MG132. iNOS was immunoprecipitated with iNOS antibody, eluted, and analyzed by SDS-PAGE. Bands representing 35S-labeled iNOS were quantitated to calculate the iNOS half-life. Data represent means ± standard deviations (n = 3). *, P < 0.05.

CHIP colocalizes with iNOS in the cytosol and translocates with iNOS to the aggresome. The above data, which demonstrated that CHIP interacted with iNOS, implied that CHIP colocalized with iNOS. To examine this possibility, we cotransfected HEK293 cells with iNOS-GFP and Flag-tagged CHIP. In cells that expressed iNOS in the cytosol and had not yet formed the iNOS aggresome, CHIP colocalized with iNOS in this compartment (Fig. 6A, row i). In contrast, in cells expressing the iNOS aggresome, CHIP was seen almost exclusively localized to the iNOS aggresome (Fig. 6A, row ii). These data suggested that the CHIP-induced iNOS aggresome was associated with translocation of CHIP to a perinuclear localization, thus colocalizing with the iNOS aggresome. Thus, CHIP's role in promoting iNOS aggresome formation may involve a role for CHIP in the homing of iNOS to the MTOC. The MTOC is at the center of aggresome accumulation (14, 16). Importantly, the CHIP-induced iNOS aggresome was highly ubiquitin positive (Fig. 6A, row iii), suggesting that CHIP-induced iNOS ubiquitination may also serve to target iNOS to the aggresome.


Figure 6
View larger version (29K):
[in this window]
[in a new window]

  		FIG. 6. CHIP colocalizes with iNOS aggresome. (A) HEK293 cells were cotransfected with a plasmid encoding the cDNA of iNOS-GFP and with a plasmid containing a vector as a control or Flag-tagged CHIP. The molar ratio of the iNOS plasmid to the coplasmid was 1:10. Forty eight hours after transfection, cells were fixed and examined by fluorescence microscopy. Exogenously expressed CHIP colocalized with cytosolic iNOS (row i) and translocated with iNOS to the aggresome (row ii). iNOS aggresomes in CHIP-transfected cells were ubiquitin enriched (row iii). (B) Endogenous CHIP colocalized with the iNOS aggresome in primary airway epithelial cells cultured at the air-liquid interphase (row i), in RT4 cells (row ii), and in HEK293 cells (row iii). Primary cells and RT4 cells expressed iNOS following cytokine stimulation, whereas HEK293 cells stably expressed iNOS-GFP. Scale bar, 10 µm.

Endogenous CHIP colocalizes with the iNOS aggresome. The translocation of exogenous CHIP to the aggresome prompted us to investigate if endogenous CHIP colocalized with the iNOS aggresome. Lung bronchial epithelial cells are the principal cell type responsible for iNOS production in response to cytokines and inflammatory mediators in the pathogenesis of airway inflammation (10). We applied a model of culturing primary bronchial epithelial cells in an air-liquid interface by using an in vitro culture system. Primary cells differentiate to a heterogeneous population containing secretory, ciliated, and basal cells that mimic their in vivo appearance and function (1, 17). iNOS, stimulated with cytokines in fully differentiated primary bronchial epithelial cells, was detected at the aggresome where it colocalized with CHIP (Fig. 6B, row i). In RT4 cells stimulated with cytokines for 16 h to induce iNOS, CHIP colocalized with the iNOS aggresome (Fig. 6B, row ii). HEK293 cells stably expressing iNOS-GFP were treated with a 10 µM concentration of the proteasomal inhibitor MG132 for 12 h to enhance iNOS aggresome formation. Endogenous CHIP was then evaluated by immunofluorescence with anti-CHIP antibody. CHIP colocalized with the iNOS aggresome (Fig. 6B, row iii).

CHIP's ubiquitin ligase activity is required for CHIP's role in aggresome formation. We studied the effect of CHIP mutants, following their cotransfection with iNOS in HEK293 cells, on iNOS aggresome formation. WT CHIP markedly increased the number of cells with iNOS aggresomes (Fig. 7). Although CHIP-K30A induced iNOS aggresomes to a much lesser extent than WT CHIP, the effect was still significant (Fig. 7, graph). This finding is consistent with the CHIP-K30A effect on iNOS ubiquitination (Fig. 4D) in that both results imply a weak but direct interaction between CHIP and iNOS, independent of chaperone binding.


Figure 7
View larger version (26K):
[in this window]
[in a new window]

  		FIG. 7. Ubiquitin ligase activity of CHIP is required for aggresome formation. HEK293 cells were cotransfected with a plasmid encoding the cDNA of human iNOS and with either a plasmid encoding WT CHIP (row i) or CHIP-H260Q. The molar ratio of the iNOS plasmid to the coplasmid was 1:5. Forty-eight hours after transfection, cells were fixed and immunostained with antibodies against His-tagged CHIP, ubiquitin, or {gamma}-tubulin. Graphs show quantitation of the percentage of cells expressing iNOS aggresome and preaggresome structures. Data represent means ± standard deviations (n = 3). *, P < 0.05; **, P < 0.001 (compared to control condition). Scale bar, 10 µm.

Interestingly, CHIP-H260Q induced a unique cellular phenotype. CHIP-H260Q caused an increase in iNOS preaggresomal structures, but it prevented the formation of mature iNOS aggresomes at the MTOC (Fig. 7, row ii). Although qualitatively similar to results of CHIP knockdown shown above in Fig. 2 for CHIP shRNA knockdown, the preaggresomal structures induced by CHIP-H260Q were larger in size and accounted for the majority of cellular iNOS. Importantly, CHIP-H260Q almost exclusively colocalized with iNOS in these preaggresomal structures. These structures were found to be ubiquitin negative (Fig. 7, row iii) and failed to colocalize with {gamma}-tubulin at the MTOC (Fig. 7, row iv). These data confirm and shed more light on the biochemical data shown in Fig. 4. Both biochemical and microscopy data suggest that CHIP-H260Q binds to iNOS, but because of lack of ubiquitin ligase activity there is a failure to release iNOS to the aggresome.

The above data suggested that CHIP ubiquitin ligase activity is required for its role in aggresome formation. To study the underlying mechanisms for failure of preaggresomal structures to form mature aggresomes in CHIP-deficient cells, we evaluated preaggresomal structures for the presence of ubiquitinated proteins. In HEK293 cells expressing iNOS-GFP, the iNOS aggresome was enriched in ubiquitin (Fig. 8A). In contrast, knockdown of CHIP in these cells resulted in formation of preaggresomal structures that were ubiquitin negative. These data suggest that CHIP-induced ubiquitination of iNOS is an important mechanism for iNOS aggresome formation. To further confirm these mechanistic observations, we studied the effect of CHIP knockdown on the formation of aggresomes by GFP-250, a cytosolic protein chimera. This protein is not ubiquitinated and is thus considered a prototype for the formation of aggresomes by nonubiquinated proteins (9, 15). Interestingly, in contrast to effect of CHIP on aggresomes formed by iNOS and CFTR{Delta}F508, knockdown of CHIP had no effect on aggresome formation by GFP-250 (Fig. 8B).


Figure 8
View larger version (43K):
[in this window]
[in a new window]

  		FIG. 8. Ubiquitin ligase activity is required for CHIP's role in aggresome formation. HEK293 cells were transfected for 48 h with lentivirus expressing either control shRNA or shRNA specific for CHIP. Cells were then transfected for 24 h with plasmids expressing either iNOS-GFP (A) or GFP-250 (B) and incubated for 3 h in the presence of a 10 µM concentration of the proteasome inhibitor MG132. Cells were then immunostained with ubiquitin or CHIP antibodies. Scale bar, 10 µm.

Disruption of dynein-dependent microtubular transport causes an aggresome phenotype similar to that produced by knockdown of CHIP. Because knockdown of endogenous CHIP or overexpression of CHIP-H260Q trapped iNOS in preaggresomal structures, we hypothesized that the above phenotype is caused by a failure to transport iNOS to the MTOC. To test this hypothesis, we investigated the effect on iNOS aggresome formation of disrupting the microtubule-dynein transport system. HEK293 cells stably expressing iNOS-GFP were treated with dimethyl sulfoxide (DMSO; vehicle) or 1 µM nocodazole, a microtubular depolymerizing agent. Treatment of nocodazole prevented MG132-induced iNOS aggresome formation (Fig. 9A). Instead, iNOS was sequestered in preaggresome structures, similar to those seen following CHIP knockdown (Fig. 2). Similar results were found when cells were treated with 1 mM of the dynein motor inhibitor EHNA (Fig. 9B). Dynein/dynactin-associated minus-end motor activity can also be experimentally inhibited by overexpressing the p50/dynamitin component of the dynactin complex (9). Disruption of the dynein motor complex with overexpression of dynamitin subunit p50/dynamitin prevented iNOS aggresome formation and sequestrated iNOS into the preaggresome structure (Fig. 9C). These data indicated that iNOS was transported by the microtubule-dynein motor transport system from cytoplasm to perinucleus MTOC region to form the mature aggresome. The similarity of the phenotype produced above to preaggresomes formed by CHIP knockdown suggests that CHIP is required for iNOS transport to the MTOC. We then investigated the underlying mechanism for such a requirement.


Figure 9
View larger version (37K):
[in this window]
[in a new window]

  		FIG. 9. Disruption of dynein-dependent microtubular transport leads to accumulation of preaggresomal structures and prevents iNOS aggresome formation. HEK293 cells stably expressing iNOS-GFP were fixed and analyzed by fluorescence microscopy. (A) Cells were pretreated with DMSO (vehicle) or 1 µM nocodazole for 1 h, followed by either vehicle or 1 µM nocodazole plus 10 µM MG132 for 3 h. (B) Experiments were done as in panel A, except that 1 mM EHNA was used instead of nocodazole. (C) Cells were transfected with control vector or Flag-tagged p50. Twenty-four hours after transfection, cells were treated with 10 µM MG132 for 4 h, fixed, and immunostained with flag antibody.

CHIP promoted interaction between iNOS and HDAC6. It has been recently shown that HDAC6 regulates aggresome formation by serving as an adaptor for anchoring ubiquitinated proteins to the dynein motor for transport to the MTOC (15). Our data above showed that the iNOS aggresome is ubiquitin enriched and that aggresome formation is enhanced by CHIP but not by a ubiquitination-deficient CHIP-H260Q mutant, suggesting that CHIP-induced iNOS ubiquitination is required for aggresome formation. Therefore, we hypothesized that the underlying mechanisms for that requirement could be mediated by HDAC6 binding to iNOS following iNOS ubiquitination by CHIP. We first investigated the possibility of iNOS interaction with HDAC6. HEK293 cells were cotransfected with iNOS and CHIP, CHIP mutants, or a control vector. A coimmunoprecipitation assay was carried out using iNOS or HDAC6 antibodies. Transfection of WT CHIP dramatically increased the interaction of iNOS and HDAC6 (Fig. 10A). Transfection of CHIP-K30A had a less significant effect on the interaction between iNOS and HDAC6. Importantly, although CHIP-H260Q has a stronger interaction with iNOS, it reduced the interaction of iNOS and HDAC6, suggesting that CHIP-induced iNOS ubiquitination was a key event required for iNOS interaction with HDAC6. To confirm this hypothesis, we studied the effect of knockdown of CHIP on the interaction of iNOS and HDAC6. HEK293 cells stably expressing iNOS were transfected for 72 h with control shRNA or CHIP shRNA. Cells were then treated with 10 µM MG132 for 3 h, and coimmunoprecipitation analysis was carried out using anti-iNOS and anti-HDAC6 antibodies. Knockdown of CHIP reduced the interaction of iNOS and HDAC6 (Fig. 10B), suggesting that CHIP is required for iNOS interaction with HDAC6.


Figure 10
View larger version (41K):
[in this window]
[in a new window]

  		FIG. 10. CHIP promotes HDAC6-mediated iNOS aggresome formation. (A) CHIP increases the association of iNOS with HDAC6. HEK293 cells were cotransfected for 24 h with a plasmid encoding iNOS and with a plasmid containing control vector, WT CHIP, the CHIP-H260Q mutant, or the CHIP-K30A mutant. The molar ratio of the iNOS plasmid to the coplasmid was 1:1. Coimmunoprecipitation was carried out on cell lysates using antibodies against iNOS or HDAC6. Immunoprecipitated proteins were analyzed by Western blotting for the presence of iNOS or HDAC6. Immunoprecipitation (IP) with irrelevant antibody (I{kappa}B-β) was used as a negative control. Western analysis (lower panel) of cell lysates was done prior to immunoprecipitation using equal aliquots corresponding to 2.5% of amount of proteins used for immunoprecipitation. (B) Knockdown of CHIP decreases the interaction of iNOS and HDAC6. HEK293 cells were transduced for 48 h with lentiviral vector expressing either control shRNA or CHIP shRNA and then transfected with iNOS cDNA for 24 h. Coimmunoprecipitation (IP) and Western analysis were done as described in panel A. (C) HDAC6 colocalizes with the iNOS aggresome but not with cytosolic iNOS or preaggresomal structures caused by CHIP-H260Q. (i) HEK293 cells stably expressing iNOS-GFP without aggresome formation. (ii) Cells exhibiting iNOS aggresome following MG132 treatment. (iii) Cells with iNOS aggresome promoted by overexpression of WT-CHIP. (iv) Cells with iNOS preaggresomal structures promoted by overexpression of CHIP-H260Q. (D) Knockdown of HDAC6 prevents iNOS aggresome formation. HEK293 cells stably expressing iNOS-GFP were transfected with vector encoding control shRNA or shRNA specific for HDAC6 for 3 days followed by another 3-day transfection with the same vectors to ensure knockdown of HDAC6. Western analysis of cell lysates was performed with antibodies against HDAC6, iNOS, acetylated tubulin, or tubulin (upper panel). Cells were treated with 10 µM MG132 for 10 h, fixed, and analyzed by immunofluorescence with HDAC6 antibody (middle panel). The graph shows quantitation of the percentage of cells expressing iNOS aggresome or preaggresome structures. Data represent means ± standard deviations (n = 3). *, P < 0.05. Scale bar, 10 µm.

HDAC6 regulates iNOS aggresome formation. The above data implied that HDAC6 played an important role in iNOS aggresome formation. Thus, we designed experiments to prove this hypothesis directly. HEK293 cells stably expressing iNOS-GFP were treated with or without MG132 for 16 h to promote iNOS aggresome formation and then fixed and immunostained with HDAC6 antibody. In cells that do not express the iNOS aggresome, HDAC6 was evenly distributed in the cytoplasm (Fig. 10C, row i). In contrast, in cells treated with MG132, HDAC6 translocated into the perinuclear region and colocalized with the iNOS aggresome (Fig. 10C, row ii). More importantly, HDAC6 colocalized with iNOS aggresomes that were promoted by overexpression of CHIP (Fig. 10C, row iii) but not with preaggresome structures that were induced by overexpression of CHIP-H260Q (Fig. 10C, row iv). These data suggested that CHIP promotes iNOS aggresome formation by ubiquitinating iNOS and thus facilitating the iNOS interaction with HDAC6. That hypothesis would predict that HDAC6 is essential for iNOS aggresome formation. To test this hypothesis directly, HEK293 cells stably expressing iNOS-GFP were transfected with control shRNA or HDAC6 shRNA. Western blot analysis showed that knockdown of HDAC6 dramatically increased acetylated {alpha}-tubulin but had no effect on the level of iNOS or {alpha}-tubulin (Fig. 10D, upper panel). Cells were then treated with vehicle or MG132 for 10 h and evaluated by fluorescence microscopy. Cells transfected with control shRNA formed iNOS aggresomes and HDAC6 colocalized with iNOS aggresomes. In contrast, knockdown of HDAC6 prevented iNOS aggresome formation, and iNOS was sequestrated in preaggresome structures (Fig. 10D). These data suggest that HDAC6 is required for iNOS aggresome formation and that CHIP's role in promoting iNOS aggresome formation is mediated by HDAC6.

Our data suggested that CHIP initially triaged iNOS to the proteasome and then to the aggresome. We hypothesized that the switch from proteasomal degradation to aggresomal sequestration could be triggered by an overwhelmed proteasomal capacity caused indirectly by CHIP's targeting proteins to the proteasome. We therefore investigated if cotransfection of cells with iNOS and CHIP would result in proteasomal overload, coincident with the increase in aggresome formation observed above. To test this hypothesis, we used HEK293 cells stably expressing GFP-u, an unstable version of GFP that is rapidly degraded and thus can only be detected when the proteasome degradation capacity is reduced, e.g., with MG132 (see Fig. S5A in the supplemental material) (5). Cells were cotransfected with cDNAs of iNOS and with either CHIP or a control vector. At 24 h following transfection, GFP-u was not visible, consistent with its rapid degradation (see Fig. S5B in the supplemental material). However, at 48 h posttransfection, GFP-u accumulated in cells cotransfected with both CHIP and iNOS but not in cells transfected with iNOS and vector only.

Our data suggest that ubiquitination of iNOS by CHIP is required not only for targeting iNOS for proteasomal degradation but also for targeting iNOS to aggresome sequestration. Further, HDAC6 acts as an adaptor to anchor ubiquitinated iNOS to the dynein motor for transport to the MTOC. Disruption of preaggresome transport to the aggresome was experimentally produced by CHIP knockdown, HDAC6 knockdown, overexpression of the CHIP-H260Q mutant, or by general inhibition of the dynein microtubular transport. The resulting cellular phenotypes under all of the above conditions were quite similar and showed accumulation of preaggresomal structures that fail to reach the MTOC. The common underlying mechanism is a failure in one of the steps to ubiquitinate iNOS, load iNOS to the dynein motor, or transport iNOS to the MTOC.

Taken together, our data suggest a model in which CHIP is an effector for both proteasomal degradation and aggresomal sequestration (Fig. 11). The CHIP interaction with iNOS is mediated by CHIP's chaperone-binding domain. CHIP's U-box domain recruits the E2 ubiquitin conjugation enzyme and ubiquitinates iNOS. Ubiquitinated iNOS is targeted for proteasomal degradation and to aggresome sequestration. This mechanism is accelerated by proteasomal inhibition. CHIP-induced iNOS ubiquitination promotes association of iNOS to HDAC6, which serves as a linker between ubiquitinated iNOS and the dynein motor. Dynein motor-dependent microtubular transport moves iNOS to the aggresome.


Figure 11
View larger version (30K):
[in this window]
[in a new window]

  		FIG. 11. Model for CHIP regulation of iNOS degradation and aggresome formation. CHIP interaction with iNOS is mediated by CHIP's chaperone-binding domain. CHIP's U-box domain recruits the E2 ubiquitin conjugation enzyme and ubiquitinates iNOS. Ubiquitinated iNOS is targeted for proteasomal degradation and to aggresome sequestration. The latter mechanism is accelerated by proteasomal inhibition. CHIP-induced iNOS ubiquitination promotes association of iNOS to HDAC6, which serves as a linker between ubiquitinated iNOS and the dynein motor. Dynein motor-dependent microtubular transport moves iNOS to the aggresome.

Our study reveals an important role for CHIP in triaging proteins to the aggresome. Although previous work has shown CHIP's role in promoting proteasomal degradation, this study identifies CHIP as a cellular effector for both proteasomal degradation and aggresome sequestration. CHIP's initial role in targeting proteins for proteasomal degradation has been suggested as a means for the cell to terminate attempts at chaperone-mediated refolding of a given protein and to rapidly degrade it (3, 6, 20). CHIP is an excellent candidate for such a role because of its ability to interact with both the chaperone pathway and the ubiquitin proteasome pathway. It has been clearly shown, however, that the proteasome system can be overwhelmed, resulting in delayed protein degradation and aggresome formation (5). Our study shows that, under such circumstances, CHIP participates in diverting its clients to the aggresome pathway. How does CHIP do that? Based on how CHIP targets proteins to the proteasome, we hypothesized that ubiquitination of iNOS by CHIP might be required for iNOS to interact with proteins such as HDAC6 that transfer cargo to the aggresome (15). Our study suggests that CHIP is required for the HDAC6 interaction with iNOS destined for aggresomal sequestration. It has been previously shown that HDAC6 can regulate only aggresomes that comprise ubiquitinated proteins (15). Thus, CHIP is required to ubiquitinate iNOS and to make it a suitable substrate for HDAC6 that will then load ubiquitinated iNOS to the dynein motor for transfer to the MTOC. CHIP-induced aggresomes were ubiquitin enriched, suggesting that the targeted proteins were ubiquitinated. Our study further suggests that these proteins were ubiquitinated by CHIP. There was no enrichment of ubiquitin in the preaggresomal structures accumulating in the absence of CHIP. Furthermore, a CHIP mutant defective in ubiquitin ligase activity could not target iNOS to the aggresome, as WT CHIP did. These data are consistent with a model predicting that ubiquitination of iNOS by CHIP is required for targeting iNOS to the aggresome. Previously, we have shown that the aggresome pathway is not only a pathological response but also a physiologic stress response (16). Pathological aggresome formation has been implicated in the pathogenesis of several neurodegenerative diseases as well as in some genetically caused interstitial lung diseases (4, 11). Our study provides new findings that increase our understanding of these processes and suggests that CHIP-related functions might provide therapeutic targets for these disorders.


arrow
ACKNOWLEDGMENTS
 
This work was supported by NHLBI, NIAID, and AHA.

We thank Li-Yuan Yu-Lee, Bruce Stanton, and Len Neckers for providing vectors for p50, CFTR{Delta}F508-GFP and CHIP mutants, respectively. We thank members of the Eissa laboratory, particularly Katarzyna Kolodziejska and Abuduaini Abulimiti, for useful suggestions. We thank Margie Moczygemba, Li-Yuan Yu-Lee, and Francis Tsai for useful discussions and critical review of the manuscript.


arrow
FOOTNOTES
 
* Corresponding author. Mailing address: Baylor College of Medicine, One Baylor Plaza, BCM 285 Suite 535E, Houston, TX 77030. Phone: (713) 798-3657. Fax: (713) 798-2050. E-mail: teissa{at}bcm.edu Back

{triangledown} Published ahead of print on 27 October 2008. Back

{dagger} Supplemental material for this article may be found at http://mcb.asm.org/. Back


arrow
REFERENCES
 
    1
  1. Adler, K. B., and Y. Li. 2001. Airway epithelium and mucus: Intracellular signaling pathways for gene expression and secretion. Am. J. Respir. Cell Mol. Biol. 25:397-400.[Free Full Text]
    2. 2
  2. Al-Ramahi, I., Y. C. Lam, H. K. Chen, B. de Gouyon, M. Zhang, A. M. Pérez, J. Branco, M. de Haro, C. Patterson, H. R. Zoghbi, and J. Botas. 2006. CHIP protects from the neurotoxicity of expanded and wild-type ataxin-1 and promotes their ubiquitination and degradation. J. Biol. Chem. 281:26714-26724.[Abstract/Free Full Text]
    3. 3
  3. Ballinger, C. A., P. Connell, Y. Wu, Z. Hu, L. J. Thompson, L. Y. Yin, and C. Patterson. 1999. Identification of CHIP, a novel tetratricopeptide repeat-containing protein that interacts with heat shock proteins and negatively regulates chaperone functions. Mol. Cell. Biol. 19:4535-4545.[Abstract/Free Full Text]
    4. 4
  4. Beers, M. F., and S. Mulugeta. 2005. Surfactant protein C biosynthesis and its emerging role in conformational lung disease. Annu. Rev. Physiol. 67:663-696.[CrossRef][Medline]
    5. 5
  5. Bence, N. F., R. M. Sampat, and R. R. Kopito. 2001. Impairment of the ubiquitin-proteasome system by protein aggregation. Science 292:1552-1555.[Abstract/Free Full Text]
    6. 6
  6. Connell, P., C. A. Ballinger, J. Jiang, Y. Wu, L. J. Thompson, J. Hohfeld, and C. Patterson. 2001. The co-chaperone CHIP regulates protein triage decisions mediated by heat shock proteins. Nat. Cell Biol. 3:93-96.[CrossRef][Medline]
    7. 7
  7. Dickey, C. A., A. Kamal, K. Lundgren, N. Klosak, R. M. Bailey, J. Dunmore, P. Ash, S. Shoraka, J. Zlatkovic, C. B. Eckman, C. Patterson, et al. 2007. The high-affinity HSP90-CHIP complex recognizes and selectively degrades phosphorylated tau client proteins. J. Clin. Investig. 117:648-658.[CrossRef][Medline]
    8. 8
  8. Eissa, N. T., A. J. Strauss, C. M. Haggerty, E. K. Choo, S. C. Chu, and J. Moss. 1996. Alternative splicing of human inducible nitric-oxide synthase mRNA: tissue-specific regulation and induction by cytokines. J. Biol. Chem. 271:27184-27187.[Abstract/Free Full Text]
    9. 9
  9. Garcia-Mata, R., Z. Bebok, E. J. Sorscher, and E. S. Sztul. 1999. Characterization and dynamics of aggresome formation by a cytosolic GFP-chimera. J. Cell Biol. 146:1239-1254.[Abstract/Free Full Text]
    10. 10
  10. Guo, F. H. R., S. A. A. Comhair, S. Zheng, R. A. Dweik, N. T. Eissa, M. J. Thomassen, W. Calhoun, and S. C. Erzurum. 2000. Molecular mechanisms of increased nitric oxide (NO) in asthma: evidence for transcriptional and post-translational regulation of NO synthesis. J. Immunol. 164:5970-5980.[Abstract/Free Full Text]
    11. 11
  11. Iwata, A., J. C. Christianson, M. Bucci, L. M. Ellerby, N. Nukina, L. S. Forno, and R. R. Kopito. 2005. Increased susceptibility of cytoplasmic over nuclear polyglutamine aggregates to autophagic degradation. Proc. Natl. Acad. Sci. USA 102:13135-13140.[Abstract/Free Full Text]
    12. 12
  12. Jana, N. R., P. Dikshit, A. Goswami, S. Kotliarova, S. Murata, K. Tanaka, and N. Nukina. 2005. Co-chaperone CHIP associates with expanded polyglutamine protein and promotes their degradation by proteasomes. J. Biol. Chem. 280:11635-11640.[Abstract/Free Full Text]
    13. 13
  13. Jiang, J., D. Cyr, R. W. Babbitt, W. C. Sessa, and C. Patterson. 2003. Chaperone-dependent regulation of endothelial nitric-oxide synthase intracellular trafficking by the co-chaperone/ubiquitin ligase CHIP. J. Biol. Chem. 278:49332-49341.[Abstract/Free Full Text]
    14. 14
  14. Johnston, J. A., C. L. Ward, and R. R Kopito. 1998. Aggresomes: a cellular response to misfolded proteins. J. Cell Biol. 143:1883-1898.[Abstract/Free Full Text]
    15. 15
  15. Kawaguchi, Y., J. J. Kovacs, A. McLaurin, J. M. Vance, A. Ito, and T. P. Yao. 2003. The deacetylase HDAC6 regulates aggresome formation and cell viability in response to misfolded protein stress. Cell 115:727-738.[CrossRef][Medline]
    16. 16
  16. Kolodziejska, K. E., A. R. Burns, R. H. Moore, D. L. Stenoien, and N. T. Eissa. 2005. Regulation of inducible nitric oxide synthase by aggresome formation. Proc. Natl. Acad. Sci. USA 102:4854-4859.[Abstract/Free Full Text]
    17. 17
  17. Kolodziejski, P. J., J.-S. Koo, and N. T. Eissa. 2004. Regulation of inducible nitric oxide synthase by rapid cellular turnover and co-translational downregulation by dimerization inhibitors. Proc. Natl. Acad. Sci. USA 101:18141-18146.[Abstract/Free Full Text]
    18. 18
  18. Kolodziejski, P. J., A. Musial, J.-S. Koo, and N. T. Eissa. 2002. Ubiquitination of inducible nitric oxide synthase is required for its degradation. Proc. Natl. Acad. Sci. USA 99:12315-12320.[Abstract/Free Full Text]
    19. 19
  19. McClellan, A. J., S. Tam, D. Kaganovich, and J. Frydman. 2005. Protein quality control: chaperones culling corrupt conformations. Nat. Cell Biol. 7:736-741.[CrossRef][Medline]
    20. 20
  20. Meacham, G. C., C. Patterson, W. Zhang, F. M. Younger, and D. M Cyr. 2001. The Hsc70 co-chaperone CHIP targets immature CFTR for proteasomal degradation. Nat. Cell Biol. 3:100-105.[CrossRef][Medline]
    21. 21
  21. Musial, A., and N. T. Eissa. 2001. Inducible nitric oxide synthase is regulated by the proteasome degradation pathway. J. Biol. Chem. 276:24268-24273.[Abstract/Free Full Text]
    22. 22
  22. Rees, I., S. Lee, H. Kim, and F. T. Tsai. 2006. The E3 ubiquitin ligase CHIP binds the androgen receptor in a phosphorylation-dependent manner. Biochim. Biophys. Acta 1764:1073-1079.[Medline]
    23. 23
  23. Xu, W., M. Marcu, X. Yuan, E. Mimnaugh, C. Patterson, and L. Neckers. 2002. Chaperone-dependent E3 ubiquitin ligase CHIP mediates a degradative pathway for c-ErbB2/Neu. Proc. Natl. Acad. Sci. USA 99:12847-12852.[Abstract/Free Full Text]
    24. 24
  24. Yoshida, M., and Y. Xia. 2003. Heat shock protein 90 as an endogenous protein enhancer of inducible nitric-oxide synthase. J. Biol. Chem. 278:36953-36958.[Abstract/Free Full Text]

Molecular and Cellular Biology, January 2009, p. 116-128, Vol. 29, No. 1
0270-7306/09/$08.00+0     doi:10.1128/MCB.00829-08
Copyright © 2009, American Society for Microbiology. All Rights Reserved.



This article has been cited by other articles:

  • Pandit, L., Kolodziejska, K. E., Zeng, S., Eissa, N. T. (2009). The physiologic aggresome mediates cellular inactivation of iNOS. Proc. Natl. Acad. Sci. USA 106: 1211-1215 [Abstract] [Full Text]  

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Supplemental material
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Sha, Y.
Right arrow Articles by Eissa, N. T.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Sha, Y.
Right arrow Articles by Eissa, N. T.

Copyright © 2009 by the American Society for Microbiology.   For an alternate route to Journals.ASM.org, visit: http://intl-journals.asm.org | More Info»