Previous Article | Next Article ![]()
Molecular and Cellular Biology, January 2009, p. 214-228, Vol. 29, No. 1
0270-7306/09/$08.00+0 doi:10.1128/MCB.01377-08
Copyright © 2009, American Society for Microbiology. All Rights Reserved.

Dept. of Cell and Developmental Biology, University of Illinois, Urbana-Champaign, Illinois 61801,1 Program in Neuroscience and College of Medicine, University of Illinois, Urbana-Champaign, Illinois 618012
Received 30 August 2008/ Returned for modification 6 October 2008/ Accepted 9 October 2008
|
|
|---|
|
|
|---|
FMRP is primarily cytoplasmic by both immunostaining and biochemical fractionation (22, 30); however, it contains a functional, nonclassical nuclear localization sequence (NLS) near its N terminus (7, 24, 73). Immunogold studies have shown that FMRP is present in the neuronal nucleoplasm and within nuclear pores (30). In addition, the presence of FMRP in the nucleus is regulated temporally, such that at specific times during development, FMRP is predominantly nuclear. Studies in Xenopus tropicalis embryos showed that FMRP was largely nuclear 2 h postfertilization (stage 6), suggesting a special nuclear function during this developmental period (9). Zebrafish embryos also demonstrated predominantly nuclear FMRP staining very early in development, 3 h postfertilization (81). Interestingly, these time points coincide with times in development when no zygotic transcription is taking place (62), providing indirect evidence that FMRP export from the nucleus might depend on mRNA synthesis.
FMRP has been speculated to enter the nucleus to bind its mRNAs (25, 46, 78), although there is no evidence to support this assertion other than the fact that FMRP has an NLS and is occasionally nuclear. Some RNA binding proteins do enter the nucleus to associate with their mRNA cargoes and facilitate export to the cytoplasm, for example, the zipcode binding protein ZBP1 (43), hnRNP A2 (reviewed in reference 28), and Drosophila proteins Sqd (35, 38) and Y14/Tsunagi (37, 50, 53).
The nuclear protein Tap/NXF1 was originally characterized as the exporter of retroviral RNAs bearing the constitutive transport element (CTE) (11, 36, 49). Since then, Tap/NXF1 has been identified as the primary exporter of cellular mRNAs (reviewed in references 15, 44, 56, 61, and 80) by binding mRNAs directly through CTE-like elements (10, 55) or indirectly through association with other RNA binding proteins. Tap/NXF1 has been demonstrated to interact with proteins bound to the mature mRNA like the SR proteins (41, 42) and proteins in the exon junction complex, like Aly/Ref (68), supporting the idea that mRNA export is tightly coupled to splicing (reviewed in references 46 and 47).
To begin to understand how FMRP identifies and binds its collection of mRNAs, it was critical to establish where mRNA binding occurs. We hypothesized that this association takes place in the nucleus. We show here that FMRP functionally interacts with the bulk mRNA exporter Tap/NXF1, suggesting that these proteins associate through mRNAs bound in the nucleus. Further, we demonstrate that FMRP associates with the active transcription units of the lampbrush chromosomes (LBCs) in amphibian oocytes. Taken together, we provide the first direct evidence that FMRP binds mRNAs in the nucleus.
|
|
|---|
The simian virus 40 (SV40) NLS was introduced into the enhanced green fluorescent protein (EGFP)-Flag-FMRP construct (75) N terminal to Flag (hereafter referred to as SV40-FMRP) (24) using the QuikChange XL site-directed mutagenesis kit (Stratagene) and the following primers from Invitrogen that were polyacrylamide gel electrophoresis purified: SV40-F, GACGACGATGACAAGCCAAAAAAGAAGAGAAAGGTAGAGCTGGTGGTGGAAG, and SV40-R, CTTCCACCACCAGCTCTACCTTTCTCTTCTTTTTTGGCTTGTCATCGTCGTC. The primers for the removal of the nuclear export sequence (NES), as defined in references 24 and 31, containing amino acids 428 to 437 (QLRLERLQID) were as follows: F-CTATTTAAAGGAAGTAGACGAGCAGTTGCGAC and R-GTCGCAACTGCTCGTCTACTTCCTTTAAATAG. The primers for the removal of the NLS as defined in reference 24 containing amino acids 111 to 152 were as follows: F-CCGAATTCGTGAGGATGATAAAGGGTGAG and R-CCGGATCCGGTGACTTCATTGATGGA.
An N-terminal hemagglutinin (HA) tag was introduced into the SV40-FMRP construct behind a T3 promoter by a two-step PCR. The constructs were cloned using the Invitrogen TA cloning kit. The forward primers for the addition of the HA tag followed by the addition of the T3 promoter were as follows: HA, GCCGCCACCATGGGGTACCCATACGACGTGCCAGACTACGCTCCAAAAAAGAAGAGAAAGGTAGAG, and T3, GCAATTAACCCTCACTAAAGGGAACAAAAGGCCGCCACCATGGGGTACCCATACGACGTGCCAGAC. The SV40-FMRP reverse primer was TTAGGGTACTCCATTCACCAGCGGTTCCAGCCCATCTACGCTGTC.
siRNAs. The following siRNAs were obtained from Dharmacon (only the sense sequence will be given although the siRNAs were administered as a duplex): Tap/NXF1-1, CGAGAUCGCAUUCAUGUUAUU; Tap/NXF1-2, GCACACGCGUCUCAACGUUUU; Tap/NXF1-3, GGCUAUGUAUUGUAAAUGAUU; and Tap/NXF1-4, GCGAACGAUUUCCCAAGUUUU. The irrelevant siRNAs were derived from human FBX011, a putative protein arginine methyltransferase (16) that has no effect on the methylation status of FMRP (data not shown).
Fluorescence microscopy and imaging. The cells were fixed with 4% (wt/vol) formaldehyde in phosphate-buffered saline (PBS; 137 mM NaCl, 2.7 mM KCl, 10 mM Na2HPO4, 1.76 mM KH2PO4 [pH 7.4]) containing 4% (wt/vol) sucrose for 10 min at room temperature, as described previously (54). The cells were mounted in DAPI (4',6-diamidino-2-phenylidole)-containing mounting medium (1x PBS [pH 9], 15% polyvinyl alcohol, 23% glycerol, 2% 1,4-Diaza-bicyclo[2.2.2]octane, and 1 µg/ml DAPI), coverslipped, and examined by fluorescence microscopy using a Zeiss Axiovert 200 M inverted microscope at either x40 or x60 magnification using oil. For immunostaining, after the fixation procedure described above, the cells were stained with either anti-Flag (1/1,000) (Sigma, St.Louis, MO) or the anti-FMRP antibody (1a) (undiluted hybridoma supernatant) for 2 to 4 h, washed, and then incubated with 1/800 of cy3-coupled anti-mouse antibody (Jackson ImmunoResearch Laboratories, West Grove, PA), mounted, and visualized as described above.
Confocal microscopy and optical sectioning. For live imaging by confocal microscopy, the cells were plated at 2.5 x 105 cells/ml on 35-mm glass-bottom microwell dishes that were poly-D-lysine-coated (MatTek Cultureware, Ashland, MA). The next day, they were transfected as described above. Twenty-four hours later, the cells were counterstained by the addition of CellTrace BODIPY TR methyl ester (Invitrogen) at a 1/5,000 dilution and cultured for 15 min in 5% CO2 at 37°C, and the medium was replaced with fresh complete medium. The cells were imaged at x63 magnification with a Zeiss LSM510 confocal microscope using the fluorescein isothiocyanate and Cy5 settings.
The cells prepared for fluorescence microscopy were examined by confocal microscopy using the Leica SP2 laser-scanning confocal with the Argon (Ar+) laser line at 488 nm for GFP and the 785-nm line from an fs pulse Ti-sapphire laser (two-photon microscopy) for DAPI imaging. The cells were prepared for fluorescence microscopy and fixed in DAPI containing mounting medium. Optical sections of cells expressing FMRP constructs were taken using the Zeiss Axiovert 200 M inverted microscope with the Zeiss Apotome structured illumination system to increase the wide-field fluorescence contrast and for optical sectioning.
RNase A treatment. Cos-7 cells transfected with SV40-FMRP and Tap 2 siRNA were treated with RNase A as described previously (67). Briefly, 36 h after transfection, the cells were preextracted in CSK buffer (10 mM PIPES [pH 6.8], 100 mM NaCl, 300 mM sucrose, 3 mM MgCl2) and incubated on ice with CSK containing 0.05% Triton X-100 for 2 to 3 min. The cells were washed twice with CSK buffer before being treated with RNase A (1 mg/ml; Sigma) for 5 to 10 min and then washed once in CSK, fixed in 4% paraformaldehyde for 15 min, and mounted as described with DAPI-containing mounting medium.
The cellular distribution of FMRP was scored for cytoplasmic or nuclear distribution by viewing multiple fields at x20 magnification and counting between 100 and 200 cells with visible nuclei verified by the DAPI stain. The percentage of cells that expressed the EGFP-tagged FMRP construct (EGFP-FMRP) primarily in the nucleus was averaged from the results of three or four independent experiments, and the standard deviation was calculated. The numbers were analyzed and plotted in GraphPad Prism 4. The significance was calculated using Student's one-tailed t test.
Calculation of the ratios of total nuclear fluorescence to total cellular fluorescence. The consistency of scoring was evaluated by determining the ratio of total nuclear fluorescence to total cellular fluorescence. Using images captured at x20 magnification, 20 representative cells of the three categories of cellular distribution were selected from each treatment category. Nuclei were demarcated by DAPI nuclear staining, and the quantification of the fluorescence intensity in the compartments of each cell was determined using Axiovision software. Total fluorescence was determined by obtaining the average fluorescence of the selection multiplied by the area of the selection. This value was obtained for both nuclear and whole-cell measurements. Total nuclear fluorescence was then divided by total cellular fluorescence to obtain the ratio of nuclear to total cellular fluorescence in each scoring category. A one-way analysis of variance was performed on each treatment group to determine whether fluorescence was significantly different between the analyzed cells scored as cytoplasmic, nuclear, or evenly distributed. Each category of cellular localization was significantly different from the other. The cells scored as cytoplasmic were compared to wild-type (WT) EGFP-FMRP treated with TAP-irrelevant peptide and were not significantly different across treatments.
Antibodies and Western blotting. The anti-FMRP antibody 1a obtained from Jean-Louis Mandel at the Institute of Genetics in Illkirch, France, was used as a hybridoma supernatant for immunoblotting at a 1/10 dilution. Antibody reactivity was visualized using an anti-mouse horseradish-peroxidase conjugate (Jackson Laboratories). The rabbit anti-Tap/NXF1 antibodies (mixed 1/800 each) used for the experiment for which the results are depicted in Fig. 2 were obtained from Genway (San Diego, CA) and Protein Tech Group (Chicago, IL). These antibodies were also used in Fig. 7 for immunoprecipitation. The rabbit anti-Tap/NXF1 used for the experiment for which the results are depicted in Fig. 6D was provided by Marie Louise Hammarskjold and used at 1/1,000. The rabbit anti-Tap/NXF1 used for the experiment for which the results are depicted in Fig. 6E was provided by Lyne Levesque and used at 1/1,000. The rabbit anti-FMRP K1 antibody was provided by Andre Hoogeveen and used at a 1/2,000 dilution. The antibody against eIF-5 was obtained from Santa Cruz and used at a concentration of 1/10,000. Reactivity was visualized using an anti-rabbit horseradish-peroxidase conjugate (Amersham) and developed with ECL (Amersham). Quantification was performed using NIH Image.
![]() View larger version (34K): [in a new window] |
FIG. 2. The reduction of Tap/NXF1 expression results in the nuclear accumulation of EGFP-FMRP and SV40-FMRP. (A) Cos-7 cells were mock treated with an irrelevant siRNA (M) or treated with a mixture of the four siRNAs against Tap/NXF1 (All) at a final concentration of 100 nM or individually with each of the four Tap/NXF1 siRNAs (1 to 4). Forty-eight hours later, the lysates were prepared and 75 µg of each were resolved on 7.5% SDS-polyacrylamide gel electrophoresis gels. The last three lanes contain dilutions of the mock: 50% (37.5 µg), 25% (18.8 µg), and 12.5% (9.4 µg). The blot was probed with affinity-purified anti-Tap antisera and reprobed with anti-eIF-5 as a loading control. The amount of Tap per lane was calculated using NIH Image and shown as the percent reduction from the mock. (B to D) Cos-7 cells were transfected with SV40 FMRP and the siRNAs indicated as follows: an irrelevant siRNA (B), a mixture of the four Tap/NXF1 siRNAs (Tap All) (C), and Tap/NXF1-2 siRNA (D). The cells were imaged for the expression of EGFP (green, left panels) and nuclei (blue DAPI stain, middle panels), and the EGFP and DAPI images were merged (right panels). (E, F) Cos-7 cells transfected with either EGFP-FMRP (E) or EGFP-SV40-FMRP (F) and treated with either the irrelevant siRNA, a mixture of the four Tap/NXF1 siRNAs (Tap All), or the individual Tap/NXF1 siRNAs (Tap 1 to 4) for 48 h and scored for the percentage of cells with a primarily nuclear accumulation of FMRP. The percentage of cells expressing FMRP in the nucleus is indicated by each bar. The results were plotted using GraphPad Prism 4. Significance was calculated using a one-tailed Student's t test. A single star indicates a P of <0.05, and two stars indicate a P of <0.01. (G) Cos-7 cells were transfected with SV40 FMRP and the Tap/NXF1-2 siRNA. Twenty-four hours later, the cytoplasmic counterstain CellTrace BODIPY TR methyl ester (Invitrogen) was added, and the cells were live imaged with a confocal microscope at x63 magnification with oil for EGFP (green, left panels) and cytoplasm stain (blue, middle panels), and the EGFP and BODIPY images were merged (right panels).
|
![]() View larger version (27K): [in a new window] |
FIG. 7. Tap/NXF1 associates with FMRP in a complex with FMR1 mRNA. (A) Schematic showing the reimmunoprecipitation experiment. Transfected cells were treated with formaldehyde (cross-linked) and then immunoprecipitated with the anti-FMRP antibody 7G1-1. Immunoprecipitated complexes were eluted with the 7G1-1 peptide and reimmunoprecipitated (Re-IP) with an anti-Tap antibody. RNA was extracted and analyzed from the complex. (B) Cos-7 cells were mock-transfected (m) or transfected with EGFP-FMRP (WT) or EGFP-FMRP and Flag-Tap (WT Tap) and immunoblotted (ib) with an anti-Flag antibody (Flag). (C) The anti-Tap/NXF1 antibodies immunoprecipitate with 15% efficiency. Cos-7 cells were mock transfected (m) or transfected with Flag-Tap (F-Tap); 50 µg was loaded per lane (wcl, whole cell lysate). Two different anti-Tap/NXF1 antibodies (IP-1 and IP-2) were used to immunoprecipitate extracts from mock or Flag-Tap-expressing cells. (D) FMRP immunoprecipitations (IP) from mock-treated Cos-7 cells (m), EGFP-FMRP-expressing Cos-7 cells (WT), or EGFP-FMRP- and Flag-Tap/NXF1-expressing Cos-7 cells (WT Tap) were peptide eluted. RNA was extracted from mock and WT peptide elutions. The peptide elution from WT Tap was reimmunoprecipitated with the anti-Tap/NXF1 antibody from which the RNA was extracted. First-strand synthesis was performed, followed by PCR for FMR1 mRNA. +, RT-PCR from Cos-7 cell total RNA.
|
![]() View larger version (55K): [in a new window] |
FIG. 6. The retention of EGFP-FMRP in the nucleus in the absence of Tap/NXF1 is RNA dependent. Cos-7 cells were plated and transfected with SV40-FMRP and Tap/NXF1-2 siRNA, permeabilized with 0.05% Triton (A) (top, cells expressing SV40-FMRP in the nucleus; bottom, cells expressing SV40-FMRP in the cytoplasm), and treated with RNase (B). (C) The percentage of cells expressing FMRP in the nucleus is indicated by each bar. The results were plotted using GraphPad Prism 4. (D) Cos-7 cells were either untransfected (M) or transfected with EGFP-FMRP (WT) or SV40-FMRP (SV40) (WCL, whole cell lysate [50 µg/lane]), immunoprecipitated (IP) with the anti-FMRP antibody 7G1-1, washed with buffer containing RNase (+) or not (–) and immunoblotted for endogenous Tap/NXF1 (Tap) coimmunoprecipitation and FMRP transgene (bottom). Non-sp, reactivity to an irrelevant protein; Ig, immunoprecipitating antibody alone; ib, immunoblot. (E) Cos-7 cells were either mock transfected (M) or transfected with Flag-Tap/NXF1 (F-Tap) alone or with Flag-Tap/NXF1 and one of the following constructs: FMRP (WT), SV40-FMRP (SV40), or I304N. Cells were treated with 0.5% formaldehyde and sonicated as described in Materials and Methods. Left panel, 35 µg of the lysates were loaded, resolved, and probed for transfection efficiency with the anti-Flag antibody (M2; Sigma) to visualize EGFP-FMRP expression (these constructs contain the Flag epitope) and Flag-Tap/NXF1; the eIF5 immunoblot (ib) shows equal loading. Right panel, immunoprecipitation with the anti-murine FMRP antibody 7G1-1. Immunoprecipitated FMRP was visualized using the anti-FMRP antibody K1, and Flag-Tap coimmunoprecipitation was visualized by a rabbit anti-Tap antibody.
|
Oocytes, microinjection, and nuclear spreads. Fragments of Xenopus laevis ovary were surgically removed from adult female frogs anesthetized with 0.15% tricaine methanesulfonate (MS222; Sigma Chemical, St. Louis, MO). Stage IV to VI oocytes were manually separated using fine tweezers and maintained in saline buffer OR2 (82.5 mM NaCl, 2.5 mM KCl, 1 mM CaCl2, 1 mM MgCl2, 1 mM Na2PO4, 5 mM HEPES). Glass needles were prepared using a horizontal pipette puller (P-97; Sutter Instrument Co.). Capped cRNA was transcribed in vitro from SpeI-linearized HA-SV40-FMRP cDNA using the Stratagene T3 in vitro transcription kit. RNA was isolated by phenol-chloroform extraction followed by ethanol precipitation. All injections were performed under a dissecting microscope (S; Leica) using an injector (Nanojet II; Drummond). Oocytes were injected with 20 to 30 ng of HA-SV40-FMRP cRNA and maintained at 18°C in OR2 solution supplemented with 100 µg/ml streptomycin.
Chromosomal spreads. Nuclear spreads were prepared as described in reference 66. The samples were fixed with 2% paraformaldehyde in PBS plus 1 mM MgCl2 for 1 h at room temperature. After fixation, the nuclear spreads were rinsed in PBS and blocked with 0.5% bovine serum albumin (Sigma-Aldrich) plus 0.5% gelatin (from cold-water fish) in PBS (blocking buffer) for 10 min. The immunodetection of newly made HA-tagged proteins was done using the anti-HA antibody mAb3F10 (Roche, Mannheim, Germany) as indicated in reference 66.
Images were captured on an upright LeicaDMR (Heidelberg, Germany), using a PL Fluotar 40x oil objective (numerical aperture, 1.0), a HCL FL Fluotar 100 oil objective (numerical aperture, 1.30), and a monochrome Retiga EXI charge-coupled device camera (Qimaging, Surrey, BC, Canada) driven by Invivo software (version 3.2.0; Media Cybernetics, Bethesda, MD). All images were captured at room temperature.
|
|
|---|
0.4% of the cells displayed predominantly nuclear EGFP-FMRP (Fig. 1F).
![]() View larger version (57K): [in a new window] |
FIG. 1. FMRP is efficiently exported from the nucleus in the absence of an NES and in the presence of the SV40 NLS. Cos-7 cells were plated and transfected with constructs expressing EGFP-FMRP (WT) (A); EGFP-FMRP with the NES deleted ( NES) (B, C); EGFP-SV40-FMRP (SV40-FMRP) (D); and EGFP-SV40- NES (SV40- NES), fixed in DAPI-containing mounting medium and imaged for the expression of EGFP-FMRP (green, left panels) and nuclei (blue DAPI stain, middle panels) and for the merged EGFP and DAPI images (right panels) (E). The arrows in panel B indicate cells expressing NES in the nucleus. Panel C shows NES-expressing cells examined by optical sectioning as described in Materials and Methods. The arrows in panel E indicate cells expressing comparable amounts of SV40- NES in the nucleus and cytoplasm. (F) Cos-7 cells expressing EGFP-FMRP (WT), NES, SV40-FMRP (SV40), and SV40- NES were scored for the percentage of cells with a nuclear accumulation of FMRP. The results of individual experiments, where over 100 cells were scored each time, were averaged to find the percentage of cells with nuclear accumulation of FMRP for each construct. The WT and SV40 constructs were scored for primarily nuclear FMRP, while NES and EGFP-SV40- NES were scored for cells that demonstrated primarily nuclear, primarily cytoplasmic, or evenly distributed FMRP between the nucleus and cytoplasm (even).
|
NES (hereafter referred to as
NES) to the nucleus (5, 24, 73). The NES of FMRP is similar to the Rev/protein kinase A inhibitor-type NES and can even function in place of the Rev NES in an export assay (31). Further, treatment with leptomycin B, which blocks the nuclear export of proteins containing leucine-rich NESs by inhibiting interaction with CRM1/exportin 1 (33, 65, 74), resulted in some nuclear accumulation of FMRP (78). Accordingly, we found that the removal of the NES from EGFP-FMRP resulted in an increased nuclear accumulation of
NES (Fig. 1B, arrows) but not in all cells (Fig. 1F). To show that
NES was indeed in both the nucleus and the cytoplasm, we obtained optical sections through cells transfected with
NES and confirmed that the distribution of FMRP was between both the nucleus and the cytoplasm (Fig. 1C). One major conclusion is that the majority of the transfected cells exhibit cytoplasmic EGFP-FMRP even in the absence of the NES (Fig. 1B, C, and F). There are at least three possible explanations for this result. The first is that the NES is inactive in these cells. We do not suspect that this is the case because the NES was functionally defined in Cos-7 cells by conjugating it to bovine serum albumin and then showing that the nuclear injected fusion protein could be exported (24). The second possibility is that there are two distinct populations of FMRP, with the majority being exclusively cytoplasmic. The third possibility is that FMRP is efficiently exported out of the nucleus by a mechanism that is independent of its NES.
The NLS of FMRP is not a classical NLS (39); thus, the molecular requirements for its activation are not well understood. To address the possibility that only a fraction of the FMRP enters the nucleus, we attempted to direct all of the expressed EGFP-FMRP to the nucleus by adding the autonomous NLS of the SV40 large T antigen (47, 48) to the N terminus of FMRP. Surprisingly, while the SV40 NLS is a strong nuclear import signal, it did not significantly increase the amount of steady-state nuclear SV40-FMRP (Fig. 1D and F), and the percentage of cells with primarily nuclear SV40-FMRP was essentially unchanged (Fig. 1F). The SV40 NLS was effective because the removal of the NES from SV40-FMRP resulted in an increased number of cells in which the newly expressed protein was evenly distributed between the cytoplasm and the nucleus (Fig. 1E [arrows] and F). However, the percentage of cells where SV40-FMRP
NES (SV40-
NES) was exclusively nuclear only increased to 12% (Fig. 1F). The same results were obtained when the constructs were expressed in HeLa cells (data not shown). Together, these data strongly suggest the existence of an efficient mechanism—distinct from the NES-dependent export pathway—that is primarily responsible for the nuclear export of FMRP.
Tap/NXF1 knockdown increases the nuclear accumulation of FMRP. FMRP binds a large collection of mRNAs (12, 58) and has been estimated to associate with approximately 4% of brain mRNAs (6). We hypothesized that if FMRP enters the nucleus to bind mRNAs, then the bound mRNAs themselves might direct export through their association with the bulk mRNA exporter Tap/NXF1. To determine whether Tap/NXF1 is involved in the export of FMRP from the nucleus, we developed four siRNAs against Tap/NXF1 that were specific for Tap/NXF1 by a BLAST search (data not shown). Administered as a cocktail of all four siRNAs (Fig. 2A, lane All) or individually (Fig. 2A, lanes 1 to 4), the Tap/NXF1 siRNAs greatly reduced Tap/NXF1 expression in cells by 67 to 91% compared to that of the mock-treated cells, based on densitometry (Fig. 2A). Further, serial dilutions of the mock-treated cell extracts shown on the right in Fig. 2A verify that all of the Tap/NXF1 siRNA treatments did indeed reduce Tap/NXF1 expression levels by more than 70%.
To examine the role of Tap/NXF1 in the export of FMRP from the nucleus, we treated EGFP- or SV40-FMRP-expressing cells with these siRNAs. Treatment with the irrelevant siRNA resulted in very few cells showing predominantly nuclear expressions of FMRP (Fig. 2B and the first bars of E and F, respectively). Approximately 0.4% of the EGFP-FMRP-expressing cells and 2% of the SV40-FMRP-expressing cells were primarily nuclear. In contrast, the treatment of EGFP-FMRP-expressing cells with pooled siRNAs or the individual siRNAs significantly increased the number of cells with nuclear EGFP-FMRP to nearly 5%, which was an
10-fold increase over treatment with an irrelevant siRNA (Fig. 2E). The treatment of cells expressing SV40-FMRP with Tap siRNAs also resulted in a 10-fold increase in the number of cells expressing predominantly nuclear FMRP (Fig. 2C, D, and F). Because more SV40-FMRP was directed to the nucleus, the percentage of cells expressing primarily nuclear FMRP after Tap siRNA treatment was as high as 34.5% (Fig. 2F). Similarly to the results observed in Fig. 1F, the SV40 NLS was much more efficient at directing FMRP into the nucleus than the native protein (compare Fig. 2E and F). However, both populations of transfected cells showed a significant increase in the number of cells expressing FMRP in the nucleus after the reduction of Tap/NXF1 expression, underscoring the importance of this protein in the nuclear export of FMRP.
SV40-FMRP is localized in the nucleus. To ensure that SV40-FMRP was indeed localized inside the nucleus and not on the outer nuclear membrane, we live imaged transfected cells using confocal microscopy. Figure 2G shows the nuclear expression of SV40-FMRP in Tap 2 siRNA-treated cells that were counterstained with the cytoplasmic stain BODIPY that labels endoplasmic reticula, Golgi bodies, and mitochondria, leaving the nuclei unstained (4, 82). SV40-FMRP is present in the nuclei and, in some cases, subnuclear structures (Fig. 2G). Thus, under conditions of reduced Tap/NXF1 expression, FMRP accumulates in the nucleus, suggesting that FMRP binds mRNAs in the nucleus and that the complex is exported by Tap/NXF1.
The endogenous NLS directs a significant amount of FMRP into the nucleus.
To examine the efficacy of the endogenous NLS, we examined the effects of removing both the NES- and the Tap/NXF1-mediated export pathways. We found that about 5% of the cells expressing
NES were nuclear and 39% had
NES evenly distributed between the nucleus and the cytoplasm (Fig. 3, middle bars). When the
NES-expressing cells were treated with Tap/NXF1 siRNA, the number of cells with primarily nuclear expression of
NES increased to 7.6% and there was a further increase in the fraction of cells showing an even distribution of
NES between the nucleus and the cytoplasm from 39% to 57% (Fig. 3, right bars). Thus, blocking both nuclear export pathways led to the redistribution of FMRP from its primarily cytoplasmic distribution to one where the majority of cells (57%) expressed
NES evenly between the nucleus and the cytoplasm and 7.6% of the cells expressed
NES primarily in the nucleus. We conclude that a significant amount of FMRP enters the nucleus using the endogenous NLS.
![]() View larger version (17K): [in a new window] |
FIG. 3. The endogenous NLS of FMRP directs a significant amount of EGFP- NES into the nucleus. Cos-7 cells were transfected with either EGFP-FMRP (WT) or NES with irrelevant siRNA ( NES) or with Tap/NXF1-2 siRNA ( NES Tap). The cells were imaged and scored for nuclear, cytoplasmic, or even distribution between the nucleus and cytoplasm. Five independent experiments were scored and plotted using GraphPad Prism 4.
|
40 amino acid NLS from FMRP (
NLS), which is encoded within exon 5, and examined whether association with polyribosomes was affected, as evidence for a functional association with mRNAs (Fig. 4B). The removal of the NLS led to a 50% loss of FMRP from polyribosomes to the messenger RNP fractions compared to that of EGFP-FMRP (compare Fig. 4A and B). Initially, this result seemed like indirect evidence that FMRP bound mRNAs in the nucleus. However, we wanted to establish that
NLS had not lost the ability to bind RNAs because of the deletion. When we compared the ability of in vitro-synthesized EGFP-FMRP and
NLS to bind a G quartet bearing RNA (sc1) through the distal, C-terminal RNA binding domain, the RGG box (encoded within exon 15), we found
NLS to be severely compromised (Fig. 4C), suggesting that the
NLS protein is partially misfolded. Further,
NLS is unable to associate with the known binding partner autosomal paralog FXR1 in cells (Fig. 4D), whose binding site is encoded by exon 7 (72). Thus, the removal of the NLS in the N-terminal part of the protein led to a reduced ability to bind RNAs and FXR1, whose interaction sites are more distally located, suggesting that amino acids 110 to 151 are critical for the normal folding and function of FMRP.
![]() View larger version (48K): [in a new window] |
FIG. 4. Removal of the NLS impairs the function of FMRP. Immortalized Fmr1 knockout fibroblast cells (STEK) (57a) were transfected with EGFP-FMRP (WT) (A) or EGFP-FMRP in which the endogenous NLS has been removed ( NLS) (B), treated with cycloheximide, and fractionated on a linear 15 to 45% sucrose gradient. Profiles are shown as the absorbance at 254 nm, and the position of the 80S monosome is indicated at the top of each gradient. Fractions were analyzed on 7.5% gels, transferred to polyvinylidene difluoride and probed with the anti-FMRP antibody 1a to visualize transgene expression (top row), FXR1 (middle row), or eIF5 (bottom row). The amount of FMRP in each fraction was quantified using NIH Image. Removal of the NLS led to a loss of 50% of the polyribosome-associated FMRP. (C) EGFP-FMRP or NLS expressed in pSport were transcribed and translated in vitro and used in a biotinylated RNA capture assay (75). sc1 is an RNA encoding a G quartet, and the sc1 mutant (sc1 mut) is an RNA encoding a G quartet mutant unable to bind the RGG box of FMRP (18). (D) STEK cells transfected with either EGFP-FMRP (WT) or NLS transgenes were fractionated into either a postnuclear supernatant (cyto) or pelleted again (P1). FMRP was immunoprecipitated from each fraction and blotted for FXR1 or FMRP as indicated on the right. STEK extract was loaded as a control (ext), and the immunoprecipitating immunoglobulin chains (Ig) are indicated.
|
NES.
To examine the combined effects of the NES and Tap/NXF1 on cells in which all of the FMRP is directed to the nucleus, we examined the effect of Tap reduction on nuclear localization using cells expressing SV40-
NES. As shown earlier, most of the cells expressing SV40-
NES had FMRP evenly distributed between the nucleus and the cytoplasm (55%). To verify that indeed the SV40-
NES cells were expressing FMRP in both the nuclear and cytoplasmic compartments, we also performed confocal microscopy on the cells (Fig. 5B). We also found that approximately 12% of the SV40-
NES-expressing cells treated with an irrelevant siRNA were primarily nuclear (Fig. 1F and 5A and B). In contrast, treatment with either Tap 1 or Tap 2 siRNAs greatly increased the number of cells expressing primarily nuclear FMRP to 42% and 51%, respectively (Fig. 5C, D, and E). Accordingly, the amount of cells expressing SV40-
NES primarily in the cytoplasm decreased from
33% to
10% after Tap siRNA treatment (Fig. 5E, middle bars). Thus, FMRP can exit the nucleus through its NES, as well as by a Tap-mediated export pathway—presumably through its bound mRNAs—supporting our hypothesis for two mechanisms of export: one encoded by the NES of FMRP and the other by the bulk mRNA exporter Tap/NXF1.
![]() View larger version (36K): [in a new window] |
FIG. 5. Tap/NXF1 knockdown increases the nuclear accumulation of SV40- NES. (A to D) Cos-7 cells were plated and transfected with SV40- NES and the siRNAs indicated and imaged for the expression of EGFP-SV40- NES (green, left panels) and nuclei (blue DAPI stain, middle panels); the EGFP and DAPI images were merged (right panels) by inverted fluorescence microscopy (A, C) and by confocal microscopy (B, D). (E) Three independent experiments were scored for cells that expressed transgene primarily in the nucleus (nuclear), primarily in the cytoplasm (cytoplasmic), or evenly distributed between the nucleus and cytoplasm (even) after treatment with an irrelevant siRNA (irrel) or Tap 1 or 2 siRNA. The average percentage of cells is given at the bottom of the bar. The results were plotted using GraphPad Prism 4. Significance was calculated using a one-tailed Student's t test. A single star indicates a P of <0.05, two stars indicate a P of <0.01, and three stars indicate a P of <0.005. (F) Consistency of cell scoring was evaluated by calculating the ratio of total nuclear fluorescence to total cellular fluorescence and performing a one-way analysis of variance using an value of 0.05. Cells scored as cytoplasmic had an average nuclear fluorescence of 12.93% ± 2.12%, while cells scored as even had an average nuclear fluorescence of 23.37% ± 4.57% and nuclear cells had average nuclear fluorescence of 38.29% ± 3.65%. All P values were less than 0.05, and many were less than 0.001, with the exception of the SV40- NES cells treated with Tap/NXF1.
|
NES Tap/NXF1, which had an increased amount of fluorescence in the nucleus (
17%). For cells that were scored as nuclear (Fig. 5F), approximately 38% of the fluorescence was in the nucleus, which was significantly different from both the cytoplasmic and evenly distributed cells. All cells expressing EGFP-FMRP primarily in the nucleus had the same percentage of their fluorescence in the nucleus, regardless of the type of treatment and were not significantly different from one another. For cells that were described as evenly distributed, which were only observed when the NES was removed (Fig. 5F), approximately 24% of the fluorescence was found in the nucleus. Thus, this quantification shows that the scoring of cells as nuclear, evenly distributed, or cytoplasmic represents distinct and reproducible subpopulations of cells in these experiments. The nuclear association of FMRP is RNA mediated. Our hypothesis is that FMRP enters the nucleus to bind mRNAs, which then facilitate the export of the complex through the Tap/NXF1 pathway. Therefore, in the absence of Tap/NXF1, SV40-FMRP retained in the nucleus should be bound to RNA. To test this prediction, Cos-7 cells transfected with SV40-FMRP and Tap 2 siRNA were treated with RNase A, which can freely diffuse into the nucleus of permeabilized cells. We then examined the number of cells expressing nuclear SV40-FMRP. The permeabilization of the cytoplasmic membrane in the absence of RNase A did not alter the nuclear or cytoplasmic localization of SV40-FMRP (Fig. 6A). Although the Triton X-100 treatment did moderately affect the morphology of the nucleus (Fig. 6A, top panels), it did not influence the percentage of cells expressing nuclear SV40-FMRP compared to that of CSK buffer-treated cells (Fig. 6C). In contrast, RNase A treatment significantly reduced the number of cells expressing SV40-FMRP primarily in the nucleus from 36.6% to 11.9% (Fig. 6B and C). RNase A treatment did not affect SV40-FMRP-containing granules in the cytoplasm (Fig. 6B). Our data show that in the absence of Tap/NXF1, SV40-FMRP is retained in the nucleus in an RNA-dependent manner.
Using siRNAs directed to Tap/NXF1, we have established a functional relationship between Tap/NXF1 and FMRP. To determine if FMRP associates with Tap/NXF1 in an RNA-dependent manner, we immunoprecipitated EGFP-FMRP or SV40-FMRP with 7G1-1, an antibody that robustly recognizes murine FMRP (12). The immunoprecipitated complex was then treated with RNase to disrupt any RNA-mediated complexes and examined for the presence of endogenous Tap/NXF1. We found that Tap/NXF1 did indeed coimmunoprecipitate with EGFP-FMRP and SV40-FMRP in an RNA-dependent manner (Fig. 6D).
To eliminate the possibility of the postlysis association of FMRP and Tap/NXF1, we chemically cross-linked mock-transfected cells or cells expressing Flag-Tap with one of the following constructs: EGFP-FMRP, SV40-FMRP, or the FMR point mutation I304N (20). The expression of the transgenes is shown in Fig. 6E (left panel) because both the Tap/NXF1 and FMRP constructs contain the Flag epitope. Upon the immunoprecipitation with the 7G1 antibody, we found that EGFP-FMRP, SV40-FMRP, and I304N all associate with Tap/NXF1 (Fig. 6E, right panel). Like FMRP, Tap/NXF1 is also found on polyribosomes (45). The I304N mutant shuttles rapidly between the nucleus and cytoplasm more so than EGFP-FMRP (78), likely because it is not captured on polyribosomes. Since I304N is present in the nucleus but not on polyribosomes (29), the association of Tap/NXF1 with I304N provides evidence that Tap/NXF1 interaction with FMRP does not occur on polyribosomes.
Only proteins within close proximity to one another are cross-linked, as we were unable to find eIF5, an abundant but nonassociated protein, in the immunoprecipitations (data not shown). We conclude that Tap/NXF1 and FMRP do associate in cells and that this interaction does not occur on polyribosomes.
Tap/NXF1 associates with FMRP in a complex with FMR1 mRNA. Our hypothesis is that FMRP enters the nucleus to associate with its cargo mRNAs, which then facilitate the export of the FMRP-mRNA complex through association with the bulk mRNA exporter Tap/NXF1. Although two large lists of FMRP mRNA cargoes have been described (12, 58), the association with FMR1 mRNA has been the most extensively characterized (3, 6, 13, 69). In fact, just recently FMRP was described as modulating the splicing of its own mRNA (23). To determine whether the FMRP-Tap/NXF1-FMR1 mRNA complex exists, we undertook the sequential immunoprecipitation strategy shown in Fig. 7A to capture the FMRP-Tap/NXF1 complex. After cross-linking mock-transfected Cos-7 cells or Cos-7 cells either expressing EGFP-FMRP or cotransfected with both EGFP-FMRP and Flag-Tap (Fig. 7B), we immunoprecipitated EGFP-FMRP with the 7G1-1 antibody. After being extensively washed, the FMRP-containing complexes were eluted using the FMRP peptide that is recognized by 7G1-1 (12). The released FMRP-containing complexes were then reimmunoprecipitated with the anti-Tap antibody that immunoprecipitates Tap/NXF1 (Fig. 7C) to isolate EGFP-FMRP-Flag-Tap/NXF1 complexes. RNA was isolated from the FMRP-Tap/NXF1 complex and found to contain FMR1 mRNA (Fig. 7D), which was also present in the peptide elution from the EGFP-FMRP immunoprecipitation but not from the mock immunoprecipitation. We conclude that FMRP associates with Tap/NXF1 in a complex that contains FMR1 mRNA that is known to bind FMRP, providing further evidence that FMRP and Tap/NXF1 associate in an mRNA-dependent complex.
Nuclear EGFP-SV40-Flag-FMRP is not recognized efficiently by the anti-FMRP antibody 1a by immunostaining. In the studies presented here, all of the cellular assays were done with EGFP-FMRP. We also tried to examine the effect of Tap/NXF1 knockdown on endogenous FMRP localization in Cos-7 cells. To our surprise, we found that the anti-FMRP antibody 1a, which has effectively been used for immunostaining (22) and Western blotting, including the detection of the FMRP encoded by the constructs used here (75), did not consistently identify nuclear FMRP by immunostaining. We first attempted to immunostain endogenous FMRP in Tap/NXF1 siRNA-treated Cos-7 cells and saw only cytoplasmic staining (data not shown). To be sure that we were using the optimal staining conditions for the nuclear FMRP, we stained Tap/NXF1 siRNA-treated, SV40-FMRP-expressing cells with either the Flag antibody (Fig. 8B, red), which recognizes nuclear SV40-FMRP, or with the 1a antibody (Fig. 8A, red), which shows cytoplasmic staining. That SV40-FMRP is indeed in the nucleus is shown by the EGFP staining (green in Fig. 8A and B). Thus, unlike the N-terminal Flag epitope, perhaps the 1a epitope is inaccessible or buried in the nucleus.
![]() View larger version (30K): [in a new window] |
FIG. 8. Nuclear EGFP-SV40-Flag-FMRP is not recognized by the anti-FMRP antibody 1a. Cos-7 cells were transfected with SV40-FMRP and Tap siRNAs (Tap All), fixed, and permeabilized as described previously (57). The cells were stained with either the anti-FMRP antibody 1a (22) (A) or the anti-Flag antibody (M2) (B). Nuclear EGFP SV40-FMRP was observed using the green channel (left images) and by Flag staining (middle image in panel B); however, it was not detected by antibody 1a (middle image in panel A). Right images show merged DAPI staining with EGFP and anti-mouse rhodamine (red).
|
![]() View larger version (40K): [in a new window] |
FIG. 9. FMRP associates with LBCs in the nucleus. Stage V Xenopus laevis oocytes were injected with HA-SV40-WT FMRP cRNA. Nuclear spreads were prepared 24 to 48 h after injection, and the localization of FMRP was visualized using fluorescence microscopy. (A) The phase contrast image shows an LBC and associated proteins. (B) Chromosomal spreads were incubated with anti-HA antibody and visualized by fluorescence microscopy. FMRP is localized along the DNA axis and is also seen along chromosomal loops (arrows) in green. (C) Chromosomes were counterstained using DAPI and false colored in red. (D) Merged images of chromosomes and FMRP localization demonstrate that FMRP is associated with the LBCs and along a subset of chromosomal loops. The scale bar represents 5 mm. (E) Uninjected control oocytes were prepared in parallel to injected oocytes. The phase contrast image shows a single chromosome. (F) Anti-HA antibody staining. (G) Counterstaining using DAPI and false coloring in red.
|
![]() View larger version (70K): [in a new window] |
FIG. 10. Endogenous FMRP associates with nascent transcripts in the nucleus. Xenopus oocytes were stained with the anti-Xenopus FMRP antibody K1. (A) A x40 magnification of a single chromosome visualized in phase contrast. (B) FMRP (green) is localized with the LBCs. The DNA axis is shown in red. (C) A x100 magnification shows single-stranded loops (indicated by arrows) of DNA extending off the axis in phase contrast. Scale bar represents 2 mm. (D) FMRP (green) is localized with the LBCs. The DNA axis is shown in red. Phase contrast of an LBC (E), stained with rabbit preimmune antisera (F), and counterstained using DAPI and false colored in red (G).
|
|
|
|---|
Role of Tap/NXF1 on the export of FMRP from the nucleus. Tap/NXF1 was originally characterized as the exporter of retroviral RNAs bearing a CTE (11, 36, 49). Tap/NXF1 has since been identified as the primary exporter of mRNAs (reviewed in references 15, 44, 56, 61, and 80). Although Tap/NXF1 has an RNA binding domain, it is of relatively low affinity (49). Thus, there are two mechanisms by which Tap/NXF1 is proposed to export mRNAs: the first is by directly binding the CTE-like elements in the mRNAs themselves; the second is by directly interacting with proteins bound to the mature mRNA (41, 42). At this time, we are not certain through which of these mechanisms Tap/NXF1 mediates the export of FMRP-mRNA complexes. CTEs have been found in mammalian genes, specifically, in the Tap/NXF1 gene itself (55) and in the Wilms' tumor gene (10). It is possible that some of the RNAs bound by FMRP contain a CTE; alternatively, and probably more likely, the mRNAs bound by FMRP are also bound by proteins associated with mature splicing like the exon junction complex component Aly/Ref (52, 53), which directly associate with Tap/NXF1 (76).
Although we observed that both the NES and Tap/NXF1 were critical for the export of FMRP from the nucleus, we were unable to identify a condition where all of the cells expressed exclusively nuclear FMRP, leading one to speculate on how FMRP exits the nucleus efficiently in the rest of the cells. One possible explanation is that any residual Tap/NXF1 expression in cells after siRNA treatment facilitates export. It is also possible that other export factors facilitate the export of FMRP. NXF2, another NXF family member, has highly conserved architecture and is also capable of mRNA export (79). In fact, NXF2 has been shown to associate with FMRP and is also present in testes and brain (79, 87). NXF2 has also been proposed to destabilize Tap/NXF1 mRNA when associated with FMRP (87). Perhaps in cells where FMRP and NXF2 are expressed, a reduction in Tap/NXF1 expression is desirable to either increase the nuclear accumulation of FMRP or permit the association of FMRP with NXF2 in the absence of Tap/NXF1. Primarily found in the brain and testes and not highly expressed in cells used in tissue culture, NXF2 may perform tissue-specific functions that likely have not influenced the function of Tap/NXF1 in our experiments.
FMRP and Tap/NXF1 functionally associate. In addition to that shown in our study, a functional association between Tap/NXF1 and FMRP has already been shown to occur during Drosophila development (59). The small bristles gene encodes the Drosophila ortholog of Tap/NXF1 (85). During cleavage furrow formation, blocking Tap/NXF-1 expression using the conditional small bristles mutant results in a dramatic change in the cytoplasmic state of Drosophila FMRP. In the absence of exported zygotic transcripts, Drosophila FMRP moves from relatively diffuse punctate structures to large polymorphic structures. Thus, the cytoplasmic particles containing Drosophila FMRP are dynamic in response to new transcripts (59).
In the studies mentioned earlier, it was suggested that FMRP interacts with the Tap/NXF family member NXF2 but not with Tap/NXF1 (51, 87). This conclusion was drawn in part from the inability to coimmunoprecipitate Tap/NXF1 with FMRP. Our study differs from that work in two ways: (i) we used a robust FMRP-immunoprecipitating antibody, 7G1-1, to capture FMRP complexes (12) in contrast to the antibody used for the studies described previously (51, 87), which has been characterized as working only for immunostains and Western blots (14, 19, 22), and (ii) we suspect that the association with FMRP is transient and likely mediated by RNA. We found that FMRP and Tap/NXF1 do indeed associate in an mRNA-containing complex that is captured using cross-linking and disrupted upon RNase treatment. More importantly, in addition to demonstrating a physical association, we show a functional effect of the loss of Tap/NXF1 on FMRP localization in cells.
FMRP's NLS. We showed that the reduction of Tap/NXF1 in cells expressing EGFP-FMRP resulted in the nuclear accumulation of FMRP and that the removal of both Tap/NXF1 and the NES led to the majority of cells expressing some FMRP in the nucleus. Thus, FMRP's endogenous NLS is functional, as has been reported before (24); however, the SV40 NLS is much more efficient at directing FMRP into the nucleus. One explanation for the relative weakness of FMRP's NLS might be that it requires additional factors to be activated. Perhaps cell-type or cell-cycle-specific proteins facilitate the nuclear import of FMRP under specific conditions, as in the early stages of Xenopus and zebrafish development when FMRP is primarily nuclear (9, 81). In contrast, the removal of FMRP's NLS led to an improperly functioning protein that could not be evaluated for its ability to traffic in cells. Naturally occurring splice variants of FMRP retain normal protein function after the removal of some domains like the RGG box and the NES (5, 26), suggesting that FMRP behaves more modularly in the C terminus.
In conclusion, prior studies established that FMRP resides in the nucleus under certain conditions, although it was not known what its function was there. It has been long speculated that FMRP binds its mRNA cargoes in the nucleus, but the evidence has been lacking. By demonstrating a functional and physical association with the primary RNA exporter Tap/NXF1 and also by visualizing FMRP association with the LBCs, we provide the first evidence that FMRP can enter the nucleus to bind its mRNA cargoes.
We thank members of the lab for their thoughtful reading of earlier drafts of the manuscript and Chris Schoenherr, Bill Greenough, and Andy Belmont for providing helpful comments. We also thank Marie Louise Hammarskjold, Lyne Levesque, and Andre Hoogeveen for providing antibodies and constructs; Lin-Feng Chen for the use of his fluorescent microscope; Kannanganattu Prasanth for advice and constructs for the RNase treatment of cells; and Edouard Khandjian for providing the STEK cells. Finally, we thank Erin Patton for input on the beginning stages of this project and for making some of the constructs and reagents used here.
Published ahead of print on 20 October 2008. ![]()
|
|
|---|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Copyright © 2009 by the American Society for Microbiology. For an alternate route to Journals.ASM.org, visit: http://intl-journals.asm.org | More Info»