Erratum for Pardo et al., Mol. Cell. Biol. 23 (21) 7600-7610.
This Article
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Pardo, O. E.
Right arrow Articles by Downward, J.
Right arrow Search for Related Content
PubMed
Right arrow Articles by Pardo, O. E.
Right arrow Articles by Downward, J.

 Previous Article  |  Next Article 

Molecular and Cellular Biology, August 2004, p. 6887, Vol. 24, No. 15
0270-7306/04/$08.00+0     DOI: 10.1128/MCB.24.15.6887.2004

ERRATUM

Fibroblast Growth Factor 2-Mediated Translational Control of IAPs Blocks Mitochondrial Release of Smac/DIABLO and Apoptosis in Small Cell Lung Cancer Cells

Olivier E. Pardo, Adeline Lesay, Alexandre Arcaro, Rita Lopes, Bee Ling Ng, Patricia H. Warne, Iain A. McNeish, Teresa D. Tetley, Nicholas R. Lemoine, Huseyin Mehmet, Michael J. Seckl, and Julian Downward

Lung Cancer Biology Group and Molecular Oncology Unit, Cancer Research UK, and Weston Laboratories, Imperial College London, Hammersmith Campus, London W12 0NN, Signal Transduction Laboratory, Cancer Research UK, London W2A 3PX, and Lung Cell Biology, National Heart and Lung Institute, Imperial College London, Royal Brompton Campus, London SW3, United Kingdom

Volume 23, no. 21, p. 7600-7610, 2003. Page 7601, column 1, Materials and Methods: Lines 16 to 19 should read as follows: "GATCCCCGGAGATACCGTGCGGTGCTTTCAAGAGAAGCACCGCACGGTATCTCCTTTTTGGAAA (X1) was annealed with the reverse sequence AGCTTTTCCAAAAAGGAGTACCGTGCGGTGCTTCTCTTGAAAGCACCGCACGGTATCTCCGGG."


Molecular and Cellular Biology, August 2004, p. 6887, Vol. 24, No. 15
0270-7306/04/$08.00+0     DOI: 10.1128/MCB.24.15.6887.2004





This Article
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Pardo, O. E.
Right arrow Articles by Downward, J.
Right arrow Search for Related Content
PubMed
Right arrow Articles by Pardo, O. E.
Right arrow Articles by Downward, J.