Article Figures & Data
Figures
- Fig. 1.
Pathways of fatty acid elongation, LCB, and sphingolipid synthesis in S. cerevisiae. Palmitoyl-CoA is synthesized from acetyl-CoA and malonyl-CoA by soluble FAS. Palmitoyl-CoA is elongated to a C26 VLCFA by a membrane-associated fatty acid elongating system (A, left branch). Each cycle of elongation requires four successive reactions and lengthens the growing fatty acid by two carbon units; condensation of malonyl-CoA with the acyl-CoA substrate, reduction of the 3-ketoacyl-CoA, dehydration of the 3-hydroxyacyl-CoA, and reduction of the trans-2,3-acyl-CoA. Although the intermediates and the product of the elongation cycle are shown as CoA derivatives, this has not yet been experimentally confirmed. The organization of the elongating enzymes with respect to each other is unknown. The LCBs are synthesized by the pathway shown in the right branch of panel A; the pathway for the conversion of ceramide to mature sphingolipids is shown in panel B.
- Fig. 2.
A mutation in the TSC13 gene suppresses the Ca2+ sensitivity of the csg2Δ mutant and confers temperature-sensitive lethality. The elo2Δ andelo3Δ mutations also suppress the Ca2+sensitivity of the csg2Δ mutant, and thetsc13-1 mutation displays synthetic growth phenotypes with the elo2Δ and elo3Δ mutations. The indicated strains (Table 1) were grown in SD medium to an OD600 of 0.1 and then diluted 1/100 into the wells of a microtiter plate. The cells were transferred to plates containing the indicated medium with or without 50 mM CaCl2 (Ca), and the plates were incubated at 26°C for 3 days or 37°C for 2 days.
- Fig. 3.
The Tsc13p and SC2 proteins are members of an evolutionarily conserved family of proteins. (a) Alignment of rat, human, Arabidopsis thaliana (arab),Schizosaccharomyces pombe (pombe), and S. cerevisiae (cere) homologs. The tsc13-1 mutant allele has a substitution of lysine for the highly conserved glutamine at residue 81 of the S. cerevisiae protein (marked with an asterisk). (b) All of the Tsc13p/SC2 protein homologs have similar hydrophilicity profiles. Segments of the proteins with the potential to span the membrane are indicated in black.
- Fig. 4.
The tsc13-1, elo2Δ, andelo3Δ mutants accumulate high levels of free LCBs. LCBs were extracted from 10 OD600 units of the indicated cells, separated by TLC, and visualized by ninhydrin staining. The LCB standards sphingosine (SPH), dihydrosphingosine (DHS), phytosphingosine (PHS), and 3-ketosphingosine (3-KS) were spotted in lane 1 (positions indicated). The ninhydrin-reactive species that migrate just below DHS and near the origin (indicated by the arrows) are phosphatidylserine (PS) and phosphatidylethanolamine (PE).
- Fig. 5.
The tsc13-1, elo2Δ, andelo3Δ mutants accumulate ceramides with chain lengths shorter than C26. (a) Ceramides were extracted from 10 OD600 units of the indicated cells, separated by TLC, and visualized by charring. Bovine ceramide type III (consisting of sphingosine and C16 fatty acid) and type IV (consisting of sphingosine and α-OH-C16 fatty acid) standards are present in lanes 1 and 2. The predominant ceramide in wild-type cells (C-ceramide) consists of phytosphingosine and α-OH-C26fatty acid. The D-ceramide is presumed to contain dihydroxy-VLCFA and phytosphingosine. (b) Ceramides from the indicated mutants were analyzed as for panel a. Deletion of SCS7 prevented hydroxylation of the fatty acid on the α-carbon, causing the ceramides to become more hydrophobic. (c) Ceramides purified from wild-type (wt) and tsc13-1, elo2Δ, andelo3Δ mutant cells were hydrolyzed to generate fatty acid methyl esters, and the extracted methyl esters were subjected to GC-mass spectrometry. The hydrophilic ceramides in the mutants (purified from the region of the TLC below C-ceramide as indicated by the bracket in panel a) contained α-hydroxylated fatty acids with chain lengths of less than C26. A mock extraction of the silica gel was conducted, and the background spectrum was subtracted.
- Fig. 6.
The elongase mutants are deficient in synthesis of VLCFAs and accumulate hydroxylated fatty acids with chain lengths shorter than C26. Fatty acid methyl esters were derived from wild-type (wt) and tsc13-1, elo2Δ, andelo3Δ mutant cells and analyzed by GC. The mass of each fatty acid species per cell was determined by comparison to an internal standard that was added to the cells prior to the methanolysis reaction. (a) Mass of total nonhydroxylated fatty acids in cells (log scale); (b) mass of total hydroxylated fatty acids.
- Fig. 7.
The tsc13 mutant cells have normal condensation activity but are deficient in total fatty acid chain elongation. (a) Fatty acid elongation activities in wild-type (wt) andtsc13 mutant microsomes were compared using C16-, C18-, and C20-CoAs as substrates by measuring the incorporation of radiolabeled malonyl-CoA into hexane-extractable fatty acids. The assays were conducted in the absence of NADPH or NADH to measure condensation activity and in the presence of NADPH or NADH to measure total elongation. Activities are normalized to the overall activity measured with wild-type microsomes, using C20-CoA as the substrate. ND, not determined. The assays were conducted in triplicate, and the results were averaged. The variation was less than 7%. (b) The elongation assays were conducted as for panel a, using C16-CoA as the substrate and either wild-type (left) or tsc13 mutant (right) microsomes. The reactions were stopped at the indicated times, and the fatty acids were extracted and separated by TLC. The reactions were conducted with (lanes 1 to 6) or without (lanes 7 to 12) NADPH or NADH. The positions of the 3-ketostearate (3-Keto), stearate, trans-2,3-stearate (Trans-2,3), and 3-hydroxystearate (3-Hydroxy) intermediates were determined by running the standards on the TLC plate and charring after exposure to PhosphorImager screens.
- Fig. 8.
Tsc13p coimmunoprecipitates with Elo2p and with Elo3p. Microsomes were prepared from strain TDY2058 cells containing no tagged proteins (lanes 5 and 9) or the same cells containing only Myc-tagged Tsc13p (lanes 6 and 10), Myc-tagged Tsc13p and HA-tagged Elo2p (lanes 1, 3, 7, and 11) or Myc-tagged Tsc13p and HA-tagged Elo3p (lanes 2, 4, 8, and 12); 10 μg of total microsomal protein was loaded in lanes 1 and 2. The microsomes were solubilized, and the 100,000 × g supernatant was used for immunoprecipitation experiments using anti-GST (lanes 3 and 4), anti-HA (lanes 5 to 8), or anti-Myc (lanes 9 to 12) antibodies. The immunoprecipitated proteins were separated by SDS-PAGE (12% gel) and analyzed by immunoblotting with HRP-conjugated anti-Myc (top panel) or anti-HA (bottom panel) antibodies.
- Fig. 9.
(A) C-terminally tagged Tsc13p-GFP shows a typical ER localization pattern and, in addition, is highly enriched in a region of the nuclear envelope adjacent to the vacuole. Selected cells are shown at higher magnification in the lower panel. (B) Elo2p-GFP, Elo3p-GFP, and Opi3p-GFP localize to the ER; i.e., around the nucleus and at the cell periphery. a, GFP fluorescence; b, FM4-64-labeled vacuolar membranes; c, DIC transmission images. Each scale bar is 10 μm.
- Fig. 10.
(A) Time course of GAL1Ppromoter-controlled Elo2p-GFP induction after shift from glucose to galactose-containing medium, determined at 0, 30, 60, and 120 min. The lower row shows corresponding DIC transmission images. The high background signal at 0 min is due to the high amplification settings on the microscope and the background fluorescence of the culture medium. (B) Tsc13p-GFP localizes to sites of nucleus-vacuole interaction inelo2 and elo3 mutants. elo2 andelo3 mutants show multilobed vacuoles; nevertheless, Tsc13p-GFP appears predominantly at sites between the nuclear envelope and vacuoles. a, GFP fluorescence; b, FM4-64 fluorescence; c, DIC transmission image.
- Fig. 11.
(A) Karmellae are distinctly different from the structures labeled by Tsc13p-GFP. Karmellae form upon overexpression of an Hmg1p-GFP construct (a, GFP fluorescence); orientation of karmellae localized on the nuclear envelope is always on the opposite site of the vacuole (b, FM4-64 staining). c, DIC transmission image. (B) Enrichment of Tsc13p-GFP to the sites of nucleus-vacuole interaction depends on the presence of vacuolar membranes. pep3 mutants contain vestigial vacuoles (b, FM4-64 staining); localization of Tsc13p-GFP appears dispersed on the surface of the nuclear membrane; polarization of the GFP signal is absent (a). c, DIC transmission image.
Tables
- Table 1.
Yeast strains used in this study
Strain Genotype TDY2037 matα lys2 ura3-52 trp1Δ leu2Δ TDY2038 matα csg2::LEU2 lys2 ura3-52 trp1Δ leu2Δ TDY2050 mat a tsc13-1 csg2::LEU2 ade2-101 ura 3-52 trp1Δ leu2Δ TDY2055 mat a elo2::URA3 csg2::LEU2 his4-619 ura3-52 trp1Δ leu2Δ lys2 TDY2056 mat a elo3::URA3 csg2::LEU2 his4-619 ura3-52 trp1Δ leu2Δ lys2 TDY2051 matα tsc13-1 ade2-101 ura3-52 trp1Δ leu2Δ lys2 TDY2053 mat a elo2::URA3 his4-619 ura3-52 trp1Δ leu2Δ TDY2054 mat a elo3::URA3 his4-619 ura3-52 trp1Δ leu2Δ TDY2057 matα elo2::TRP1 tsc13-1 ade2-101 ura3-52 trp1Δ leu2Δ lys2 TDY2058 matα elo3::TRP1 tsc13-1 ade2-101 ura3-52 trp1Δ leu2Δ FY1679a mat a/αura3-52/ura3-52 leu2Δ1/+trp1Δ63/+his3Δ200/+ DTY10A mat a leu2-3,112 can1-100 ura3-1 ade2-1 his3-11,15 (TRP1+) DTY004 mat a elo2::HIS3 leu2-3, 112 can1-100 ura3-1 ade2-1 SEY002b matα acc1t s (mtr7) lys? leu2 ade2 his3 SEY003c matα aac1 c s leu2-3,112 ura3-1 ade2-1 his3-11,15 can1-100 SEY004d mat a acc1-2150 lys? leu2 ade2 ura3 BJ9367e matα pep3::TRP1 ura3-52 leu2-Δ1 his3-Δ200 trp1 RW9065f mat a ade2 his3-Δ200 lys2-801 ura3-52 met? {pGAL1-HMG1} CSY10A mat a elo3::HIS3 leu2-3,112 can1-10 ura3-1 ade2-1 CSY10Aelo2/HA-ELO mat a elo2::HIS3 can1-100 ura3-1 ade2-1{pADH1-HA-ELO2-LEU2} CSY10Aelo3/HA-ELO3 mat a elo3::HIS3 can1-100 ura3-1 ade2-1{pADH1-HA-ELO3-LEU2} CSY10Aelo2/GFP-ELO2 mat a elo2::HIS3 can1-100 ura3-1 ade2-1{pGAL1-GFP-ELO2-LEU2} - Table 2.
Sequences of oligonucleotides used for cloning, tagging, and disrupting TSC13, ELO2, and ELO3
Oligonucleotide Sequencea 12201 5′-GGCCGCGGCCGCGGGCAACTTAGATTTATCCG-3′ 12200 5′-GGCCGTCGACGTACTTACATATTTGCATAGT-3′ 12449 5′-TTTGAATTTAATTTGAAA-ATGCCTAGGATCACCATAAAAAGC-3′ 12450 5′-GCTTTTTATGGTGATCCTAGGCATTTTCAAATTAAATTCAAA-3′ ELO2F-SAL1 5′-CGCAGGTCGACCATGAATTCACTCGTTACTC-3′ ELO2R 5′-TTCACACAGGAAACAG-3′ ELO3F-SAL1 5′-CGCAGGTCGACCATGAACACTACCACATCTAC-3′ ELO3R 5′-GTCCTGCGATTTTATTCG-3′ 9041 5′-GGCCGGATCCTCCAGACTGTGAATAAAC-3′ 9042 5′-GGCCGGATCCGTATCACTACTCCTCACTGT-3′ 9043 5′-GGCCGGATCCGTACGTATTCACATGTCCTG-3′ 9044 5′-GGCCGGATCCTAGACATGACTGTCGAAAGG-3′ ↵a Restriction sites referred to in the text are underlined.
- Table 3.
Sequences of oligonucleotides used for constructing Tsc13p-GFP and Opi3p-GFP
Oligonucleotide Sequencea pYDL015cGA5→ 5′-caaaaagtatcataccagaagagcattcttgattccatttgtatttGGAGCAGGTGCTGGTGCTGGTGCTGGAGCA-3′ pYDL015cMX6← 5′-gctaatatctctttaccttgcatttgggcatgttgcaaacaggagga tca ATCGATGAATTCGAGCTCGTTTAAAC-3′ pYDL015c→ 5′-gtaacgctaagatccgtgtc-3′ pOPI3GA5→ 5′-ccttttactgccatgatctacgctaaccgtgataaggccaaaaagaatatgGGAGCAGGTGCTGGTGCTGGTGCTGGAGCA-3′ pOPI3MX6← 5′-cggtaatagcataggcttctaacattatagaatatatagaaatagagcac tca ATCGATGAATTCGAGCTCGTTTAAAC-3′ pOPI3→ 5′-ggatgagagagtcaccggc-3′ kanMX-reverse← 5′-ctagcggatctgccggtagag-3′ pGFP4← 5′-ggtcaatttaccgtaagt-3′ ↵a Lowercase, coding gene sequence; italic, 3′ untranslated region gene sequence; uppercase lightface, GA5 linker sequence (30 bp); uppercase boldface, kanMX6 sequence (26 bp); underlined, stop codon.
