Aryl Hydrocarbon Receptor-Mediated Transcription: Ligand-Dependent Recruitment of Estrogen Receptor α to 2,3,7,8-Tetrachlorodibenzo- p-Dioxin-Responsive Promoters

Chemicals and plasmids.Antibodies used for ChIP include the following: for ERα, H-184 and HC-20; for AhR, H-211; for ARNT, H-172; for p300, N-15; for CBP, A-22 (all from Santa Cruz Biotechnology, Santa Cruz, CA); for RNAPII phosphorylated at serines 2 and 5, 8WG16 (Covance, Berkeley, CA); and for acetyl-histone H3, 06-599 (Upstate, Lake Placid, NY). Rabbit polyclonal antibodies against TRAP220 (49) and TIF2 (25) have been described previously. TCDD was provided by S. Safe (Texas A&M University, College Station, TX), and 17β-estradiol was from Sigma (St. Louis, MO). The plasmids p1A1LUC, containing the −1612 to +292 region of the hCYP1A1 promoter (36); XRE-luc (45); pSG5-hERα (48); pSG5-hERβ (51); pSG5-HEO; pSG5-HEO-S118A (55); and pSG5-hERα-ΔAF1 (pSG5-hERα-Δ182) (6) have been described previously.

Cell culture and transient transfection.MCF-7 human breast carcinoma cells were cultured in Dulbecco's modified Eagle's medium (DMEM; Invitrogen Corp.) supplemented with 5% fetal calf serum (FCS; Invitrogen Corp.). T47D breast carcinoma cells were cultured in a 1:1 mixture of DMEM and F12 media (Invitrogen Corp.) supplemented with 5% FCS (Invitrogen Corp.). HuH7 human liver carcinoma cells were also cultured in DMEM containing a high glucose concentration and supplemented with 10% FCS. All media were supplemented with 2 mM l-glutamine and 1% penicillin-streptomycin, and cells were maintained at 37°C in 5% CO₂. For transient-transfection experiments, HuH7 cells were seeded in 24-well plates in phenol red-free DMEM supplemented with 5% dextran-coated charcoal (DCC)-treated FCS 24 h before transfections. Cells were transfected with Lipofectamine 2000 according to the manufacturer's recommendations (Invitrogen Corp.). All reaction mixtures included 10 ng of pCH110-β-Gal (Pharmacia) to normalize for transfection efficiency. After transfection, cells were treated with ligands for 24 h before luciferase (Biothema, Dalarö, Sweden) and β-galactosidase assays were performed (Tropix, Bedford, MA).

ChIP.MCF-7 and T47D cells were seeded in 150-mm dishes and grown for 3 days in phenol red-free medium supplemented with 5% DCC-treated FCS. Ligands dissolved in dimethyl sulfoxide (DMSO) were added for the indicated times, and protein-DNA complexes were cross-linked with 1% formaldehyde for 10 min. Cross-linking was quenched by adding 125 mM glycine, and cells were washed with phosphate-buffered saline, harvested, and resuspended in lysis buffer (50 mM Tris-HCl [pH 8.0], 150 mM NaCl, 1 mM EDTA, 1% Triton X-100, 0.1% Na-deoxycholate) containing protease inhibitors (Roche, Mannheim, Germany) and sonicated 10 times for 10 s each time. The soluble chromatin was collected by centrifugation, and an aliquot of the chromatin was put aside and represented the input fraction. The supernatants were incubated with 30 μl of protein A/G Sepharose (50% slurry; Pharmacia) under gentle agitation for 2 h at 4°C. The supernatant was transferred to a new microcentrifuge tube, and 0.5 to 1 μg of antibody was added and incubated overnight at 4°C. Protein A/G-Sepharose (20 μl of a 50% slurry) was then added and incubated for 1.5 h. The pellets were successively washed for 10 min in 1 ml of buffer 1 (20 mM Tris-HCl [pH 8.0], 150 mM NaCl, 2 mM EDTA, 1% Triton X-100, 0.1% sodium dodecyl sulfate [SDS]), 1 ml of buffer 2 (20 mM Tris-HCl [pH 8.0], 500 mM NaCl, 2 mM EDTA, 1% Triton X-100, 0.1% SDS), 1 ml of LiCl buffer (20 mM Tris-HCl [pH 8.0], 250 mM LiCl, 1 mM EDTA, 1% NP-40, 1% Na-deoxycholate), and 2 × 1 ml of TE (10 mM Tris-HCl [pH 8.0], 1 mM EDTA). Protein-DNA complexes were eluted in 120 μl of elution buffer (TE, 1% SDS) for 30 min, and the cross-links were reversed by overnight incubation at 65°C. DNA was purified using a PCR purification kit (QIAGEN) and eluted in 50 μl. ChIP DNA (5 μl) was amplified by PCR with primers 5′ACCCGCCACCCTTCGACAGTTC3′ and 5′TGCCCAGGCGTTGCGTGAGAAG3′ for the CYP1A1 enhancer region, 5′CTTGGAATTGGGACTTCCAGGTGT3′ and 5′TTATAGGCGGGCTTGTACGTGTG3′ for the CYP1A1 TATA box region, 5′CATGTCGGCCACGGAGTTTCTTC3′ and 5′ACAGTGCCAGGTGCGGGTTCTTTC3′ for the nonspecific primers in the CYP1A1 coding region, 5′GTGCGCACGGAGGTGGCGATA3′ and 5′GCTCCTCCCGCGCTTCTCAC3′ for CYP1B1, and 5′GGCCATCTCTCACTATGAATCACT3′ and 5′GGATTTGCTGATAGACAGAGACGA3′ for pS2. For real-time PCR, SYBR green qPCR supermix UDG (Invitrogen) was used to amplify a smaller fragment of the CYP1A1 promoter as described previously (15); 5′ATATGACTGGAGCCGACTTTCC3′ and 5′GGCGAACTTTATCGGGTTGA3′ for CYP1B1 and the same primer pairs as described above were also used for pS2.

RNA isolation, RNA interference (RNAi), and real-time PCR.MCF-7 and T47D cells were seeded in six-well plates and grown in phenol red-free DMEM supplemented with 5% DCC-treated FCS for 2 days prior to treatment with ligands. HuH7 cells were seeded in six-well plates 24 h before transfection with Lipofectamine 2000 (Invitrogen Corp.) and cotreated with 10 nM E2 and 10 nM TCDD for the indicated times. For the RNAi experiments, small interfering RNA (siRNA) oligonucleotides for ERα (5′TCAAGGACATAACGACTAT′3) and luciferase (5′ATAAGGCTATGAAGAGATA′3) were cloned into pSUPERIOR.puro according to the manufacturer's instructions (OligoEngine), creating pSPuro-iERα and pSPuro-iLuc, respectively. T47D cells were seeded in six-well plates and grown in phenol red-free DMEM supplemented with 5% DCC-treated FCS for 24 h before transfection with Lipofectamine 2000 (Invitrogen Corp.) and cotreated with ligands for 24 h. RNA was isolated using RNeasy spin columns (QIAGEN). One microgram of the extracted RNA was pretreated with DNase I for 15 min at room temperature and then reverse transcribed using random hexamer primers and SuperScriptII (Invitrogen). Real-time PCR was performed with 1 μl of the cDNA synthesis reaction using SYBR green (Invitrogen). For the CYP1A1 heteronuclear RNA (hnRNA), the primers were 5′TTGTGATCCCAGGCTCCAAGA3′ and 5′GGAGGCACCAAAATGTTCCTTT3′ (9), and for CYP1A1 mRNA, the primers were 5′TGGTCTCCCTTCTCTACACTCTTGT3′ and 5′ATTTTCCCTATTACATTAAATCAATGGTTCT3′. All target gene transcripts were normalized to the 18S rRNA (PE Applied Biosystems) content and to the time zero sample.

Kinetic assembly of AhR and regulated promoters in the presence of TCDD.The regulation of the human CYP1A1 gene is mediated by AhR recruitment to multiple XREs in its promoter. We used ChIP to investigate the coregulator dynamics of AhR-mediated transcriptional activation to CYP1A1 in MCF-7 cells. Figure 1A shows the TCDD-induced recruitment of AhR and several associated factors to the enhancer and TATA box regions of CYP1A1. Occupancy of the promoter regions by AhR and ARNT was evident after 15 min, peaking at approximately 75 to 105 min and thereafter declining during the course of the treatment. Recruitment of AhR and ARNT was closely followed by NCoA2 (TIF2/SRC2), which preceded the accumulation of the histone acetyltransferase (HAT) CBP. The arrival of the HATs coincided with that of the TRAP/SMCC/mediator complex, which was followed by histone H3 acetylation and the phosphorylation of RNAPII. No apparent cycling was observed. Simultaneous recruitment of the AhRC to the XRE-rich enhancer region approximately 1,000 bp upstream from the start site and the TATA box region suggests the formation of a larger multiprotein complex that bridges the two promoter regions. To quantitate the results from the ChIP assays, and since conventional PCR followed by gel electrophoresis may not accurately depict small changes among the different samples, the ChIP samples were also analyzed by real-time PCR; their relative enrichment levels are shown in Fig. 1B. Overall, the real-time PCR results support the data from conventional PCR presented in Fig. 1A. A comparison of genomic DNA and sonicated input samples shows that following ChIP, the amplified promoter regions represent the enrichment of distinct regions and are not the result of precipitation and amplification of large chromatin fragments (Fig. 1C). Occupancy by AhR and ARNT of a region containing two additional XREs located between the enhancer and TATA box regions, at positions −499 and −396, was also observed; however, whether the recruitment of the AhRC represents the enrichment at a distinct region is beyond the resolution of our assay (data not shown). No recruitment of AhR or ARNT was observed to a region within the CYP1A1 coding sequence, demonstrating the specific recruitment of AhRC to the 5′ regulatory region of CYP1A1 (Fig. 1D).

• Open in new tab
• Download powerpoint

FIG.1.

Temporal recruitment of AhR and associated factors to CYP1A1 regulatory regions. (A) MCF-7 human breast carcinoma cells were treated with 10 nM TCDD for the specified amounts of time (minutes). ChIP assays were performed as described in Materials and Methods with antibodies against the indicated proteins. PCRs of DNA from the input or immunoprecipitated fractions were performed using primer pairs that amplify the CYP1A1 promoter regions as indicated. (B) ChIP assay samples were analyzed by real-time PCR, and the results were normalized to time zero (no ligand). RNApol, RNA polymerase. (C) Genomic DNA and the sonicated input DNA were PCR amplified using the specified primer pairs. The sonicated input fraction was separated by 0.7% agarose gel electrophoresis and visualized by ethidium bromide staining. (D) ChIP assays with antibodies to the indicated proteins were analyzed by PCR using primer pairs covering the specified regions of CYP1A1. IgG, immunoglobulin G.

Cross talk between the AhR and ERα pathways has been well documented, and several reports have shown that ERα is important for AhR-mediated transcription; therefore, antibodies against ERα were also included into our ChIP analysis. Interestingly, we observed a TCDD-dependent recruitment of ERα to the CYP1A1 enhancer and TATA box regions (Fig. 1A and B). The temporal recruitment profile of ERα closely followed that of AhR and ARNT.

Ligand-dependent recruitment of ERα to CYP1A1 and CYP1B1 promoter regions.The influence of E2 on the TCDD-dependent recruitment of ERα to AhR-regulated target genes was investigated in MCF-7, T47D, and HuH7 cells treated with TCDD or E2 alone or in combination (TCDD+E2). The TCDD-induced ERα occupancy at the CYP1A1 enhancer was assessed using two different ERα antibodies (Fig. 2A). E2 alone had no effect, whereas together with TCDD, E2 increased the TCDD-induced ERα occupancy at CYP1A1. Real-time PCR analysis revealed that TCDD+E2 cotreatment resulted in a three- to fourfold increase in the recruitment of ERα to CYP1A1 compared with TCDD alone (Fig. 2B), whereas cotreatment had no effect on the recruitment profile of AhR. ERα was also recruited to the XRE-containing enhancer region of CYP1B1 (Fig. 2C and D), suggesting that ERα is recruited to multiple TCDD-responsive genes. The enhanced recruitment of ERα by TCDD+E2 cotreatment was greater to the CYP1B1 promoter than to CYP1A1, resulting in a sixfold increase after 60 min of treatment. The increased promoter occupancy of ERα at CYP1B1 may in part be due to the E2-dependent recruitment of ERα to an ERE located in the proximal promoter region of CYP1B1 (50). The effect of E2 on the TCDD-dependent recruitment of ERα to the CYP1A1 and CYP1B1 promoters was also investigated in T47D cells (Fig. 2E and F). Interestingly, AhR and ERα were recruited more rapidly to both CYP1A1 and CYP1B1 promoters compared to MCF-7 cells, reaching maximal promoter occupancy after 30 and 60 min. Although TCDD+E2 cotreatment had no effect on the recruitment pattern of AhR, a marked increase in the promoter occupancy by ERα at CYP1A1 and CYP1B1 was observed and was most evident at the CYP1B1 promoter (Fig. 2F). ChIP assays performed on ERα-negative HuH7 cells transiently transfected with ERα confirmed the TCDD-induced recruitment of ERα to CYP1A1, which was only observed in cells transfected with ERα (Fig. 2G and H). Similar to that observed in MCF-7 and T47D cells, E2 alone was not sufficient to increase the promoter occupancy of ERα at CYP1A1 but significantly (P < 0.05) enhanced the TCDD-dependent recruitment of ERα (Fig. 2H). These data demonstrate that TCDD induces the recruitment of ERα to AhR target genes and that the recruitment of ERα is enhanced by cotreatment with E2.

• Open in new tab
• Download powerpoint

FIG. 2.

Ligand-dependent recruitment of ERα to AhR target genes. (A) MCF-7 cells were treated with 10 nM estradiol (E2), 10 nM TCDD, 10 nM TCDD plus 10 nM E2, or DMSO (0.1%) for the indicated amounts of time. ChIP assays were performed with primer pairs specific to the XRE enhancer regions of CYP1A1 using conventional PCR (A) and real-time PCR (B). ChIP analysis of the promoter occupancy of the CYP1B1 promoter by AhR and ERα was done using conventional PCR (C) and real-time PCR (D). T47D cells were treated with 10 nM TCDD or 10 nM TCDD plus 10 nM E2, followed by ChIP and real-time PCR amplification of the CYP1A1 (E) and CYP1B1 (F) enhancer regions. HuH7 human hepatoma cells were transfected with pSG5-ERα or a vector control and treated as described for panel A for the specified amounts of time. ChIP assays were performed with primer pairs specific to the XRE-containing enhancer region of CYP1A1 using conventional PCR (G) and real-time PCR (H). Results shown are representative of at least two independent experiments. ERα antibodies used were H-184 (ERα*) and HC-20 (ERα**). IgG, immunoglobulin G.

Effect of ERα on the transcriptional activity of AhR.In transiently transfected HuH7 cells cotransfected with a luciferase reporter under the regulation of the human CYP1A1 promoter/enhancer region (p1A1LUC) and with increasing amounts of ERα expression plasmid, increasing amounts of ERα resulted in a dose-dependent potentiation of the TCDD-induced reporter gene activity to 2.5-fold above vector controls (Fig. 3A). Cotreatment of 10 nM TCDD with either 1 nM or 10 nM E2 showed that the ERα-mediated potentiation of AhR-regulated transcription was also dependent on the concentration of E2 and resulted in an up to sevenfold increase in reporter gene activity. Transfection of greater amounts of ERα resulted in a reduction in the enhancement of reporter gene activity, suggesting that the level of ERα influences its ability to act as a coregulator of AhRC activity (data not shown). Similar results were observed with HuH7 cells transiently cotransfected with a minimal XRE luciferase reporter gene (p3xXRE-LUC) and increasing amounts of ERα (Fig. 3B).

• Open in new tab
• Download powerpoint

FIG. 3.

Effect of ERα on AhR-mediated transcription. HuH7 human hepatoma cells were transiently transfected as described in Materials and Methods. Following transfection, cells were treated with the indicated compounds for 24 h prior to assaying for luciferase and β-galactosidase activities. Cells were transiently cotransfected with increasing amounts of pSG5-hERα and either p1A1LUC-containing the CYP1A1 promoter (A) or p3xXRE-LUC (B). Results are expressed as the means and standard deviations of four replicate determinations. Reporter gene activity significantly (P < 0.05) greater than the TCDD-treated vector control is indicated by an asterisk, reporter gene activity significantly (P < 0.05) greater than TCDD-treated samples transfected with the same amounts of ERα is indicated by a dagger, and reporter gene activity significantly (P < 0.01) greater than TCDD-1 nM E2-treated samples transfected with the same amounts of ERα is indicated by a double dagger. (C) Cells were cotransfected with p1A1-LUC and one of the following constructs: pSG5 (vector), pSG5-hERα (ERα), pSG5-hERβ (ERβ), pSG5-hERα-ΔAF1 (ERα ΔAF1), pSG5-HEO (ERα HEO), or pSG5-HEO S118A (HEO S118A). Reporter gene activity significantly (P < 0.05) different than the TCDD- or TCDD+E2-treated vector control is indicated by an asterisk, and reporter gene activity significantly (P < 0.05) greater than TCDD-treated samples transfected with the same ER plasmids is indicated by a number sign. (D) Cells were transiently cotransfected with p1A1LUC and either pSG5 or pSG5-hERα (ERα). Cells were treated for 24 h with a vehicle control or 10 nM TCDD or cotreated with 10 nM TCDD and 10 nM E2, 100 nM ICI 182,780, 100 nM 4-hydoxytamoxifen (TAM), or 100 nM raloxifene (RAL). Reporter gene activity significantly (P < 0.05) greater than the TCDD-treated vector control is indicated by an asterisk, and reporter gene activity significantly (P < 0.05) different than the TCDD-treated sample transfected with the ERα is indicated by a number sign. Results are representative of at least two independent experiments and are expressed as the means and standard deviations of four replicate determinations.

The ERα potentiation of AhR transcriptional activity is mediated through AF-1.ERα mediates transcription via protein-protein interactions with other transcription factors, such as AP-1 and Sp1 (33, 41). The N-terminal AF-1 domain has been shown to be an important mediator of these effects. Transfection of an ERα ΔAF-1 plasmid lacking amino acids residues 1 to 182 into HuH7 cells caused a significant reduction in reporter gene activity, and this mutant was unable to potentiate AhR-mediated transcription, even in the presence of E2, compared to wild-type ERα (Fig. 3C). ERα activity is strongly regulated by phosphorylation, in particular its AF-1 activity. Mutation of Ser 118 to Ala resulted in a substantial reduction, but not a complete inhibition, of the ability of ERα to enhance reporter gene activity, suggesting that phosphorylation of Ser 118 is important but not sufficient for ERα regulation of AhR transcriptional activity. Since some of the major functional differences between ERα and ERβ have been mapped to their respective N-terminal or AF-1 regions, we examined whether ERβ could also potentiate p1A1LUC reporter gene activity. Figure 3C shows that ERβ exhibited properties similar to those of ERα ΔAF-1. Transfection of ERβ caused a significant reduction in reporter gene activity and was unable to potentiate AhR-mediated reporter gene activity even in the presence of E2 compared to wild-type ERα, suggesting that the ER-mediated enhancement of AhR transcription exhibits ER subtype selectivity. Since the data presented in Fig. 3C demonstrated that the AF-1 region is important for mediating ERα activity at AhR-regulated promoters, we were interested in studying the effects of various selective ER modulators (SERMs) on AhR-mediated transcription (Fig. 3D). Cotreatment of HuH7 cells cotransfected with p1A1LUC and an ERα expression plasmid with TCDD and tamoxifen caused a fourfold increase over TCDD alone. Cotreatment with raloxifene resulted in a slight enhancement of reporter gene activity, whereas the ability of ERα to enhance TCDD-dependent reporter gene activity was inhibited by cotreatment with ICI 182,780. Since tamoxifen primarily inhibits AF-2 and not AF-1, while raloxifene inhibits AF-2 and also partially AF-1, and ICI 182,780 inhibits both AF-1 and AF-2 function, the data presented in Fig. 3D support the notion that the AF-1 region is important for ERα to enhance AhR signaling.

Estradiol and ERα enhance the transcription of CYP1A1 mRNA.Since transiently transfected reporter genes do not accurately represent the same complex regulation that occurs at endogenous promoters, the effect of E2 and ERα on TCDD-induced CYP1A1 transcription was assessed by real-time PCR in MCF-7, T47D, and HuH7 cells transiently transfected with ERα (Fig. 4A to E). The effect of E2 and ERα on the rate of CYP1A1 mRNA transcription, determined by reverse transcription-PCR of unprocessed hnRNA (9), and on CYP1A1 mRNA expression suggests that the recruitment of ERα to AhRC may play different roles in different cell types. In MCF-7 cells, cotreatment of TCDD+E2 did not significantly affect the transcription rate of CYP1A1 or the expression of CYP1A1 mRNA compared to TCDD treatment alone (Fig. 4A and B). In T47D cells cotreated with TCDD+E2, no significant increases (P < 0.05) in the transcription rate of CYP1A1 compared to TCDD were observed. A significant increase in CYP1A1 mRNA expression was also observed at 240 min (P < 0.05) but was not observed after 420 min (Fig. 4C and D). After 420 min of treatment, significant increases (P < 0.05) in both the transcription rate and expression of CYP1A1 mRNA were apparent in HuH7 cells transiently transfected with ERα compared with vector controls (Fig. 4E and F). In contrast to that observed in transient transfection of p1A1LUC (Fig. 3A), cotreatment of TCDD+E2 did not have a significantly different effect compared to that of TCDD alone (Fig. 4F). Collectively, these data support the notion that ERα acts as a modulator of AhRC activity in HuH7 cells.

• Open in new tab
• Download powerpoint

FIG. 4.

Real-time PCR results of the effect of ERα and estradiol on transcription at the CYP1A1 promoter. Total RNA isolated from MCF-7 cells (A, B), T47D cells (C, D), and HuH7 cells (E, F) transfected with or without ERα, treated with 10 nM TCDD or 10 nM TCDD-10 nM E2, DNase treated, and amplified with primers recognizing the hnRNA, unprocessed RNA, form of CYP1A1 or CYP1A1 mRNA. Results shown are the means and standard deviations of two independent experiments. For MCF-7 and T47D cells, RNA expression levels significantly (P < 0.05) greater than TCDD-treated time matched samples are indicated by an asterisk. For HuH7 samples RNA expression levels significantly (P < 0.05) different between the TCDD-treated time-matched vector control samples and those transfected with ERα are indicated by a asterisk, and RNA expression levels significantly (P < 0.05) different between the TCDD+E2-treated time-matched vector control samples those transfected with ERα are indicated by a number sign.

RIP140 is recruited to the pS2 but not to the CYP1A1 promoter.The coregulator composition and recruitment patterns of AhR-mediated transcription are similar to those reported for ERα, except that AhR recruits coregulators to chromatin with kinetic profiles different from those of NR coregulators (42, 52). Despite reports demonstrating that RIP140 modulates TCDD-mediated activity on an XRE-driven reporter gene (24), RIP140 was not detected on CYP1A1 enhancer or TATA box regions; however, the same antibody was able to detect recruitment of RIP140 to pS2 promoters after E2 treatment (Fig. 1A and 5A and B). In cells cotreated with E2+TCDD, recruitment of RIP140 was only observed to the pS2 and not to the CYP1A1 promoter (Fig. 5A and B). Since only one RIP140 antibody was used during these studies, one cannot exclude the possibility that the pertinent RIP140 epitope is masked in the potential AhR-RIP140 complex whereas it is available in the ERα-RIP140 complex. Nevertheless, these results suggest that the AhR and ERα signaling systems differ in their coregulator recruitment profiles during transcriptional activation.

• Open in new tab
• Download powerpoint

FIG. 5.

Ligand-dependent recruitment of RIP140 to ERα- but not AhR-regulated target genes. MCF-7 cells were treated with 10 nM estradiol (E2), 10 nM TCDD, 10 nM TCDD-10 nM E2, or DMSO (0.1%) for the indicated amounts of time. ChIP assays were performed with primer pairs specific to the XRE enhancer regions of CYP1A1 or pS2. IgG, immunoglobulin G.

Role for ERα in AhR-mediated gene expression.To investigate the potential roles of ERα and E2 in AhR signaling, experiments using RNAi for ERα were performed on T47D cells treated with TCDD and TCDD+E2. The results illustrated in Fig. 6 show that in T47D cells transfected with the pSPURO-iERα plasmid containing an siRNA for ERα caused a decrease in AhR-dependent gene expression following treatment with TCDD and TCDD+E2 compared with siRNA for luciferase as a control. E2 cotreatment, however, did not further reduce the expressed of CYP1A1 mRNA. Similar results were seen in MCF-7 cells (data not shown). These data suggest and support a previously proposed role for ERα in AhR signaling (43, 46).

• Open in new tab
• Download powerpoint

FIG. 6.

ERα plays a role in AhR-mediated activity. Effects of RNAi for ERα on AhR-dependent gene expression was assessed in T47D cells transfected with plasmids containing short hairpin RNA sequences for ERα or luciferase and treated with 10 nM TCDD or 10 nM TCDD-10 nM E2 for 24 h as described in Materials and Methods. RNA was isolated, and the CYP1A1 mRNA levels were determined using real-time PCR. The data are representative of two separate experiments. RNA expression levels significantly (P < 0.05) different between iERα (siRNA for ERα) and the iLuc (siRNA for luciferase) control are indicated by asterisks.

New mechanism of cross talk between ERα and AhR.The recruitment of ERα to AhR-regulated genes represents a new mechanism of cross talk between the two receptor paradigms. E2 treatment results in an increase in promoter occupancy of ERα, but not of AhR, at the pS2 promoter in T47D cells (Fig. 7A). Cotreatment with E2+TCDD also failed to induce the recruitment of AhR to the pS2 promoter and resulted in a reduction in the promoter occupancy of ERα after 120 min of treatment. The reduction in recruitment could reflect an increase in proteolysis of ERα (58). The same ChIP samples were then used to amplify the CYP1A1 promoter and study the time-dependent recruitment of ERα and AhR. As shown above, the recruitment of ERα parallels that of AhR and displays kinetics distinct from those of ERα recruitment at pS2. Indeed, ERα is recruited to pS2 after 5 min of treatment whereas the promoter occupancy of CYP1A1 by ERα was not evident until 15 to 30 min, suggesting that ERα has another role in the AhRC compared to its role in the activation of estrogen-responsive promoters. Of further interest is the finding that, after 120 min of cotreatment, ERα is still present on the CYP1A1 promoter but no longer at pS2. These findings were confirmed using real-time PCR of the precipitated DNA isolated from MCF-7 cells (Fig. 7B). The real-time PCR data demonstrate the distinct kinetics of ERα recruitment to the pS2 and CYP1A1 promoters. The maximum occupancy of ERα was at 30 min on pS2 (30-fold enrichment) but 60 min on CYP1A1 (14-fold enrichment). Cotreatment of TCDD+E2, however, did not alter the recruitment pattern for ERα at pS2. Nonetheless, as was observed in T47D cells, ERα is still present on the CYP1A1 promoter after 120 min of cotreatment but no longer at pS2. Collectively, these data show that TCDD induces ERα occupancy of AhR-responsive promoters, representing a new mechanism of cross talk between the ER and AhR receptor systems.

• Open in new tab
• Download powerpoint

FIG. 7.

Temporal recruitment of ERα to ER and AhR target genes. (A) T47D cells were treated with E2 (10 nM) or TCDD+E2 (10 nM each) for the indicated amounts of time. ChIP assays were performed, followed by PCR amplification of the isolated DNA using primer pairs specific for the enhancer region of CYP1A1 and the promoter of pS2. (B) MCF-7 cells were treated with E2 (10 nM) or TCDD+E2 (10 nM each) for the indicated amounts of time. ChIP assays were performed using anti-ERα antibodies, followed by real-time PCR of the isolated DNA using primer pairs specific for the CYP1A1 and pS2 promoters. The data are representative of an experiment that was repeated twice.