TRAF6 and the Three C-Terminal Lysine Sites on IRF7 Are Required for Its Ubiquitination-Mediated Activation by the Tumor Necrosis Factor Receptor Family Member Latent Membrane Protein 1

Cell lines and antibodies.Raji is an EBV-infected human Burkitt's lymphoma B-cell line with type III latency. 293 and 293T cells were derived from human kidney epithelial cells. TRAF6^+/+ and TRAF6^−/− mouse embryonic fibroblasts (MEFs) were gifts from Tak Mak (39). Raji cells were maintained in RPMI 1640 medium supplemented with 10% fetal bovine serum plus antibiotics, and 293 cells and MEFs were maintained in Dulbecco's modified Eagle's medium supplemented with 10% fetal bovine serum plus antibiotics.

Monoclonal TRAF6, Myc (5E10), Ub, hemagglutinin (HA), and His antibodies and polyclonal or monoclonal IRF7 and Ubc13 antibodies were purchased from Santa Cruz. Monoclonal Flag (M2) and tubulin antibodies were purchased from Sigma.

Constructs.pcDNA3.1-TRAF6 was a gift from Arnd Kieser (47). HA-Ub and HA-K63Ub were gifts from David Boone and Averil Ma (5). IFN-α4 promoter-Luc (IFN-α4p-Luc), Flag-IRF7, and its mutant Flag-IRF7(477A/479A) were gifts from Rongtuan Lin and John Hiscott (37). pcDNA3-LMP1 and Flag-LMP1 were kindly provided by Nancy Raab-Traub (41). The Renilla (pRL-TK) expression construct was purchased from Promega. All other constructs and mutants were made by subcloning or site-directed mutagenesis (Stratagene) and verified by sequencing.

RNA interference.The four 19-nucleotide oligonucleotides for small interfering RNA (siRNA) targeted to human Ubc13 have been described previously (68) and were synthesized (Invitrogen). The oligonucleotides of small interfering TRAF6 targeting human TRAF6 (GenBank accession numbers NM_004620 and NM_145803) were purchased from Dharmacon; the sequences are GGAGAAACCUGUUGUGAUUUU (sense) and AAUCACAACAGGUUUCUCCUU (antisense). The control siRNA, a scrambled sequence without specific targeted degradation of any known cellular mRNA, was purchased from Santa Cruz. These siRNAs were transfected into 293 cells in 12-well plates with the use of Lipofectamine 2000 according to the manufacturer's instructions.

Generation of stable TRAF shRNA (shTRAF6)-expressing Raji cell lines.The two complementary oligonucleotides for generating small hairpin RNA (shRNA) targeting TRAF6 are as follows: sense, 5′-gatccccCCACGAAGAGATAATGGATttcaagagaATCCATTATCTCTTCGTGGtttttggaaa-3′; and antisense, 5′-tcgatttccaaaaaCCACGAAGAGATAATGGATtctcttgaaATCCATTATCTCTTCGTGGggg-3′. For the negative control, the sequence targeting TRAF6 was scrambled to 5′-GCAAGCGAATCGATAAGTA-3′, which does not target any human gene. These sequences were synthesized, annealed, and inserted at the BglII/XhoI sites of the pSuper.Retro/Puro vector driven by the human H1 gene promoter (OligoEngine Inc.). Retroviral production and infection of Raji cells were performed as described previously (27). Stable transfectants were selected by culturing for 2 weeks in the presence of 0.5 μg/ml puromycin (Mediatech Inc., Manassas, VA).

Protein expression and purification.For FLAG elution, 293T cells were transfected with the Flag-IRF7 construct. After 48 h, cells were collected in phosphate-buffered saline solution and Dounce homogenized in 100 μl hypotonic lysis buffer (10 mM NaCl, 1.5 mM MgCl₂, 10 mM Tris, pH 7.5, and complete protease inhibitor cocktail [Roche]). Supernatant fluids were denatured at 95°C for 5 min with addition of sodium dodecyl sulfate (SDS) to give a final concentration of 1% and then diluted 10-fold with dilution buffer (50 mM Tris-HCl, pH 7.4, 150 mM NaCl, 1 mM EDTA, 1% Triton X-100, and complete protease inhibitors) and immunoprecipitated with anti-FLAG affinity gel (Sigma) overnight (59). Samples were eluted with 300 μg/ml FLAG peptide (Sigma) according to the manufacturer's instructions.

Protein expression and purification from Escherichia coli were performed as described previously for His-tagged proteins (17) or for glutathione S-transferase (GST)-tagged proteins (34).

In vitro and in vivo ubiquitination assays.In vitro ubiquitination assays using His-TRAF6 and Flag-IRF7 were performed as described previously (59). For GST-tagged proteins, purified GST-TRAF6 and GST-IRF7-Flag or their mutants were incubated for 3 h at 37°C in 20 μl of a reaction buffer (20 mM HEPES [pH 7.4], 10 mM MgCl₂, 1 mM dithiothreitol [DTT], 59 μM Ub, 50 nM E1, 850 nM of Ubc13-UeV1a, 1 mM ATP, 30 μM creatine phosphate, and 1 U of creatine kinase). After incubation, the beads were washed five times in buffer A (20 mM Tris, pH 7.4, 250 mM NaCl, 1 mM DTT, 1 mM sodium orthovanadate, 2 mM EDTA, 1% Triton X-100) and two times in low-salt buffer (20 mM Tris, pH 7.4, 25 mM NaCl, 1 mM DTT). Beads were then resuspended in 1% SDS (in water) and boiled for 10 min. Dissociated proteins were diluted 50 μl twice, each with 600 μl buffer A, and supernatant fluid was precleared with protein A/G beads (Santa Cruz) for 1 h and immunoprecipitated overnight with 1 μg anti-Flag M2, after which protein A/G beads were added for an additional 1 h. Beads were washed four times with buffer A and two times with low-salt buffer before Western blotting.

For the in vivo ubiquitination assay, 293 cells in six-well plates were transfected with 0.5 μg HA-Ub, 0.6 μg pCR3-FlagTRAF6, and 1.0 μg pcDNA3-IRF7 by using CalPho transfection reagent (Clontech). Cells were harvested after 36 h and lysed in 200 μl of buffer A with the addition of 10 mM N-ethylmaleimide for 30 min on ice. Three hundred micrograms of total proteins was used for immunoprecipitation (IP), and 30 μg was used for input controls. Lysates for IP were diluted with 1.2 ml of buffer A, and IP was performed with 2 μg anti-IRF7 and protein A/G-Sepharose beads (Santa Cruz) for 4 h. Beads were washed four times in buffer A and two times with low-salt buffer denatured in 50 μl of 1% SDS. A second IP was performed as described above with 1 μg anti-IRF7 and protein A/G beads overnight. Beads were washed four times with buffer A and two times with low-salt buffer before Western blotting with anti-HA.

RNA extraction and RT-PCR.RNA was extracted with the use of a Qiagen mini-RNA preparation kit, following the manufacturer's instructions. Reverse transcription (RT)-PCR was performed with the use of an RT-PCR system (Promega). cDNA products were diluted five times. Five microliters of diluted cDNA was used for IFN-stimulated gene 56 (ISG56) and IRF7 and 2 μl for actin. The primers used for PCR are as follows: for IRF7, CGCGGCACTAACGACAGGCGAG (forward) and GCTGCCGTGCCCGGAATTCCAC) (reverse); for ISG56, CCAGCGCTGGGTATGCGATCTCTGCC (forward) and GGGCCCGCTCATAGTACTCCAGGGC (reverse); and for actin, ACAATGAGCTGCTGGTGGCT (forward) and GATGGGCACAGTGTGGGTGA (reverse). PCR was performed in the linear range (30 cycles) at an annealing temperature of 60°C.

Transfection, reconstitution, IP, and immunoblotting.293 cells were transfected with Effectene reagent (Invitrogen), and MEFs were transfected with an Amaxa Nucleofector II MEF kit, following the manufacturer's instructions. Reconstitutions of TRAF6 knockout cells with Myc-TRAF6 or Myc-TRAF6(C70A) were completed by selection with 4 mg/ml G418 for 2 weeks after transfection.

For IP, transfected 293 cells in 60-mm dishes or MEFs from three combined transfections were collected 48 h after transfection. Except for those shown in Fig. 2B, cell lysates were denatured in 1% SDS at 95°C for 10 min to dissociate any noncovalently bound proteins and diluted 10× before IP, or a second IP was performed with immunoprecipitates denatured in 1% SDS at 95°C for 10 min (4, 33, 59). Proteins were separated by SDS-polyacrylamide gel electrophoresis and transferred to nitrocellulose membranes, followed by immunoblotting with the indicated antibodies, and signals were detected with an enhanced chemiluminescence kit, following the manufacturer's protocol (Amersham Pharmacia Biotech).

Luciferase assay and data analysis.Cells were transfected with the indicated expression plasmids, together with IFN-α4p-Luc. Renilla was cotransfected as an internal transfection control. Empty vector was used to equalize the total amount of DNA in all transfections. Cells were collected 24 h after transfection. Luciferase activity was measured with equal amounts (20% of the total for each sample) of protein lysates in an Lmax luminometer (Molecular Devices Corp.) with the use of a dual luciferase assay kit (Promega). The results shown are averages ± standard errors from duplicates for each sample. At least three consistent results were obtained from independent experiments, and representative results are shown. The value for the ability of the vector controls to activate IFN-α4p-Luc was set to 1.

TRAF6 activates IRF7 and enhances LMP1-promoted IRF7 activity.We propose that TRAF6 is an E3 ligase for IRF7 K63-linked ubiquitination for the following reasons: first, TRAF6 is an E3 Ub ligase for K63-linked polyubiquitination (14); second, TRAF6 is involved in LMP1 signaling (47, 57); third, TRAF6 interacts with IRF7 and activates it in response to TLR signaling (30); and last, TRAF6 can also associate with RIP, which is required for LMP1 signaling to IRF7 (27), through the adaptor protein p62 (46). However, evidence for this proposal is not complete.

Here, we first tested the effect of TRAF6 on the transcriptional activity of IRF7. Luciferase assay results show that IRF7 (Fig. 1A) is activated by TRAF6, but not by TRAF2, in a dose-dependent manner. Further, TRAF6 enhances LMP1-promoted IRF7 transcriptional activity (Fig. 1B). The results suggest that TRAF6 in involved in LMP1 activation of IRF7.

• Open in new tab
• Download powerpoint

FIG. 1.

TRAF6 activates IRF7 and enhances LMP1-stimulated IRF7 activity. 293 cells in 24-well plates were transfected with 10 ng IRF7, increasing amounts of TRAF6 or TRAF2 (+, 20 ng; ++, 50 ng; and +++, 100 ng) (A) or 20 ng TRAF6 and 50 ng LMP1 (B), 25 ng IFN-α4p-Luc, and 10 ng Renilla. Luciferase activity was measured 24 h after transfection. (A) TRAF6 but not TRAF2 activates IRF7 in a dose-dependent manner. (B) TRAF6 increases LMP1-stimulated IRF7 activity.

LMP1 activates TRAF6 and enhances its interaction with IRF7.Next, we inquired whether LMP1 could activate TRAF6 and enhance its interaction with IRF7. TRAF6 E3 ligase is activated after dimerization or oligomerization and targets itself as one of the substrates for K63-linked ubiquitination (58). 293 cells were transfected with constructs as indicated (Fig. 2). Cells were collected after 48 h, and lysates were denatured (Fig. 2A) or not denatured (Fig. 2B) before IP. Western blotting was performed with the antibodies as indicated. Figure 2A shows that in the absence of exogenous TRAF6, ubiquitination of endogenous TRAF6 is not detectable under our experimental conditions even with transient expression of HA-K63Ub (Fig. 2A, lane 1), but significant ubiquitination is detected in the sample transfected with both HA-K63Ub and Flag-LMP1 (Fig. 2A, lane 2). These results indicate that LMP1 activates TRAF6 and results in its auto-ubiquitination and are consistent with a previous report (50). This is not surprising, since LMP1 is able to engage TRAF6 (47) and therefore facilitates TRAF6 dimerization or oligomerization.

• Open in new tab
• Download powerpoint

FIG. 2.

LMP1 activates TRAF6 and enhances its association with IRF7. (A) LMP1 activates TRAF6. Endogenous TRAF6 is activated in the presence of LMP1 and HA-K63Ub and therefore autoubiquitinated (lanes 1 and 2). 293 cells in 60-mm dishes were transfected with 0.2 μg Flag-LMP1 and 0.5 μg HA-K63Ub. Transfected cells were collected for IP after 48 h. IB, immunoblotting; αTRAF6, anti-TRAF6. (B) LMP1 enhances interaction between IRF7 and TRAF6. 293 cells in 60-mm dishes were transfected with 0.2 μg pcDNA3-LMP1, 0.5 μg Flag-TRAF6, 0.5 μg Myc-IRF7, and 0.5 μg HA-K63Ub. Cells were collected for IP after 48 h.

Figure 2B shows that some TRAF6 and IRF7 proteins become associated physically when coexpressed with K63onlyUb (Fig. 2B, lane 3), and the association was enhanced in the presence of LMP1 (Fig. 2B, lane 4). Without exogenously expressed K63onlyUb, association between TRAF6 and IRF7 is also detectable but much weaker, despite the existence of LMP1 (Fig. 2B, lanes 5 and 6). These data (Fig. 2B) indicate that association of TRAF6 and IRF7 is mediated by LMP1-stimulated ubiquitination.

TRAF6-Ubc-13-mediated ubiquitination is required for IRF7 activation by LMP1.To check if TRAF6 is responsible for LMP1-mediated ubiquitination of IRF7, we used a TRAF6^−/− MEF cell line. IP with denatured proteins shows that ubiquitinated IRF7 is detected in TRAF6^+/+ cells in the absence of LMP1 and greatly increased in its presence; ubiquitination of IRF7 was not detected in TRAF6^−/− cells even in the presence of LMP1 under our experimental conditions (Fig. 3A).

• Open in new tab
• Download powerpoint

FIG. 3.

TRAF6-Ubc13-mediated, LMP1-stimulated ubiquitination and transcriptional activity of IRF7. (A and B) TRAF6^+/+ and TRAF6^−/− MEFs (5 × 10⁶) were transfected with 2 μg Flag-IRF7, 1 μg LMP1, 1.5 μg HA-K63Ub, and 0.5 μg TRAF6 or TRAF6(C70A). Forty-eight hours later, cells were collected for IP with denatured lysates. (A) LMP1 did not stimulate ubiquitination of IRF7 in TRAF6^−/− cells. IB, immunoblotting; WB, Western blotting; αFlag, anti-Flag. (B) Ubiquitination of IRF7 in response to LMP1 is recovered in TRAF6^−/− MEFs reconstituted with TRAF6 but not TRAF6(C70A). (C) Ubc13 siRNA decreases LMP1-promoted IRF7 activity. 293 cells in 12-well plates were transfected with Ubc13 siRNA with the use of Lipofectamine reagent, following the manufacturer's instructions. After 12 h, cells were transfected with 50 ng IRF7, 50 ng LMP1 or its mutants, 30 ng IFN-α4p-Luc, and 20 ng Renilla. Twelve hours later, cells were transfected with the siRNA oligonucleotides again and cultured for an additional 12 h before luciferase assays. The value for the vector control in control siRNA (siControl)-transfected cells was set to 1. (D) Endogenous Ubc13 level is reduced by expression of Ubc13 siRNA in 293 cells.

We also reconstituted TRAF6^−/− MEFs with TRAF6 or TRAF6(C70A), a mutant that has lost ligase activity, and checked the ubiquitination of IRF7 by LMP1 in these cells. In TRAF6^−/− MEFs reconstituted with TRAF6(C70A), IRF7 ubiquitination could not be detected even in the presence of LMP1. However, in TRAF6^−/− MEFs reconstituted with TRAF6, LMP1 is able to stimulate IRF7 ubiquitination (Fig. 3B).

Ubc13 and Uev1A (or the functionally equivalent MMS2) form an E2-conjugating enzyme complex named TRAF6-regulated IKK activator 1, which functions with certain E3 Ub ligases, such as TRAF2 (49), TRAF6 (14), or RAD5 (56), to catalyze K63-linked polyubiquitination. Expression of endogenous Ubc13 (Fig. 3D) in 293 cells was reduced by RNA interference. The cells were then transfected with IRF7 and LMP1 plus Ub expression vectors. Luciferase results show that IRF7 activity stimulated by LMP1 is dramatically reduced in Ubc13 siRNA-transfected cells (Fig. 3C) as well as in small interfering TRAF6-transfected cells (data not shown). Presumably, TRAF6-mediated ubiquitination is abrogated by reducing the expression of Ubc13 (14).

Together, these results indicate that LMP1 stimulates K63-linked ubiquitination and transcriptional activity of IRF7 through TRAF6-Ubc13. Ubc13 is also involved in LMP1 activation of NFκB since a dominant-negative form of Ubc13 inhibits LMP1 activation of NFκB (40).

Endogenous IRF7 ubiquitination and activity are reduced in Raji cells stably expressing the shTRAF6 construct.Further, to confirm the requirement of TRAF6 for LMP1-stimulated ubiquitination and transcriptional activity of IRF7 in an endogenous system, we knocked down expression of TRAF6 in Raji cells by expressing an shTRAF6 construct. Raji cells are B lymphocytes with an EBV type III latency phenotype and have high levels of endogenous IRF7 and LMP1, and IRF7 in these cells is highly ubiquitinated (27). As expected, when expression of TRAF6 is reduced by shTRAF6 (Fig. 4C), endogenous IRF7 transcriptional activity is reduced up to 70% (Fig. 4A). Correspondingly, ubiquitination is also significantly reduced (Fig. 4B). These results from a complete endogenous system confirm that TRAF6 is responsible for LMP1-stimulated ubiquitination and transcriptional activity of IRF7.

• Open in new tab
• Download powerpoint

FIG. 4.

Expression of shTRAF6 in Raji cells decreases endogenous ubiquitination and activity of IRF7. Raji cells with EBV type III latency were infected with shTRAF6 retrovirus. After selection for 2 weeks, cells were collected for IP or transfected with 2 μg IFN-α4p-Luc and 1 μg Renilla constructs for a luciferase assay, performed 24 h later. (A) Endogenous IRF7 activity is decreased in shTRAF6-expressing cells. (B) Endogenous ubiquitination of IRF7 is decreased in shTRAF6-expressing cells. IB, immunoblotting; αIRF7, anti-IRF7. (C) Endogenous TRAF6 level is reduced in shTRAF6-expressing cells.

IRF7 is a substrate for TRAF6 E3 ligase.To eliminate the possibility that the ubiquitination was mediated by a Ub ligase activity other than TRAF6, we expressed and purified TRAF6 from bacteria, which lacks a Ub system (33). To eliminate the possibility that IRF7 was coprecipitated with other proteins from 293T cells, cell lysates were denatured before IP to dissociate any noncovalently bound proteins (59).

As shown in Fig. 5A, ubiquitinated IRF7 is detected only in the presence of the components His-TRAF6, Ubc13-UeV1a, and K63-Ub, not in the absence of any of these components. We also used a TRAF6 mutant, His-TRAF6(C70A), in which cysteine 70, a key residue in the RING finger for TRAF6 E3 ligase activity (14), is mutated to alanine. Replacement of His-TRAF6 with His-TRAF6(C70A) did not produce detectable ubiquitination of IRF7. The results demonstrate that TRAF6 and its E3 ligase activity are required for IRF7 ubiquitination and that IRF7 is a substrate for TRAF6 E3 ligase.

• Open in new tab
• Download powerpoint

FIG. 5.

IRF7 is a substrate for TRAF6 E3 ligase and identification of IRF7 lysine sites for ubiquitination. (A) IRF7 is a substrate for TRAF6 E3 ligase. His-TRAF6 and His-TRAF6(C70A) proteins were expressed in and purified from E. coli, and Flag-IRF7 protein was expressed in and purified from 293T cells. An in vitro ubiquitination assay was performed. After the reaction, solutions were heated in 1% SDS at 95°C to dissociate protein interactions before IP with Flag antibody. Western blotting (WB) was performed with the antibodies indicated. IB, immunoblotting; αFlag, anti-Flag. (B) Identification of IRF7 ubiquitination sites. GST-IRF7-Flag and GST-TRAF6 were purified from E. coli. An in vitro ubiquitination assay was performed (see details in Materials and Methods). Samples were separated on SDS gels and immunoblotted with Ub antibody. Blots were stripped for reprobing IRF7 with Flag antibody. WT, wild type.

Lysines 444, 446, and 452 are critical for IRF7 activation.Human IRF7 variant A has 15 lysine sites in total. To identify IRF7 ubiquitination sites, we made a panel of deletion mutants and lysine-to-arginine (K→R) point mutants and expressed and purified the mutant proteins from E. coli to test their abilities to be ubiquitinated by TRAF6 in vitro. As expected, wild-type IRF7 protein is ubiquitinated in the presence of TRAF6. Also, two deletion mutants, IRF7(1-370) and IRF7(1-442), in which amino acids 371 to 503 and 443 to 503 are deleted, respectively, are ubiquitinated, indicating that IRF7 is ubiquitinated on multiple sites by TRAF6. The increased ubiquitination of the deletion mutants may be explained by the fact that deletion mutants are often assembled into a different or misfolded conformation, leading to increased ubiquitination. Although the decrease of ubiquitination of the single mutants K444R, K446R, and K452R is not significant, due to the fact that multiple sites are ubiquitinated, the triple mutant with lysines 444, 446, and 452 mutated to arginine (K444/446/452R) has consistently displayed significant reduction in ubiquitination intensity (Fig. 5B).

We also performed in vivo ubiquitination assays with these mutants, and similar results were obtained (Fig. 6A). Thus, both in vitro and in vivo ubiquitination assays indicate that IRF7 is ubiquitinated by TRAF6 on multiple lysine sites and suggest that K444, K446, and K452 may be TRAF6-targeted ubiquitination sites. To test if these ubiquitination-deficient mutants are defective in transactivation ability, we first performed luciferase assays. As seen in Fig. 6B, wild-type IRF7 strongly transactivates the IFN-α4 promoter, and IRF with lysines 373 and 375 mutated to arginine [IRF7(K373/375R)] transactivates it as well. Strikingly, single or double ubiquitination-deficient mutations of K444, K446, or K452 dramatically reduce the ability to transactivate the IFN-α4 promoter. Consistently, IRF7(K444R) has the highest reduction and IRF7(K446R) has the lowest reduction of transcriptional activity. Impressively, the triple mutant IRF7(K444/446/452R) completely loses its ability to transactivate the promoter. We also tested the abilities of the IRF7 mutants to transactivate an endogenous IRF7 target gene by measuring ISG56 mRNA with quantitative RT-PCR. Parallel results were obtained (Fig. 6C). Wild-type IRF7 and IRF7(K373/375R) stimulate ISG56 mRNA levels substantially, but other tested ubiquitination-deficient mutants did not. IRF7(K444/446/452R) and the phosphorylation-deficient mutant IRF7(1-470), which lacks all C-terminal functional phosphorylation sites, stimulated ISG56 mRNA levels only to control levels (Fig. 6C). Thus, these three of five total lysines tested are functional ubiquitination sites on IRF7; mutation of all these three sites reduces ubiquitination of IRF7 and, correspondingly, its transactivational ability.

• Open in new tab
• Download powerpoint

FIG. 6.

IRF7 lysines 444, 446, and 452 are functional ubiquitination sites. (A) Identification of IRF7 ubiquitination sites in vivo (see details in Materials and Methods). WT, wild type; IB, immunoblotting; HC, heavy chain. (B and C) Lysines 444, 446, and 452 are responsible for IRF7 transactivation ability. (B) 293 cells in 24-well plates were transfected with 125 ng IRF7 or its K→R mutants, 25 ng IFN-α4-Luc, and 10 ng Renilla plasmids. αIRF7, anti-IRF7; WT, wild type. Luciferase assays were performed 24 h after transfection. (C) 293 cells in six-well plates were transfected with 0.5 μg IRF7 or its ubiquitination-deficient mutants or the phosphorylation-deficient mutant IRF7(1-470). Forty-eight hours after transfection, RNA was extracted and RT-PCR performed for detection of ISG56, IRF7, and actin mRNA.

To confirm these observations, we tested if these ubiquitination-deficient mutants have reduced abilities to be activated by LMP1. As expected, wild-type IRF7 and IRF7(K373/375R) are similarly strongly activated by LMP1. However, IRF7(K444R), IRF7(K446R), and IRF7(K452R) all have significantly decreased activities compared to those of wild-type IRF7 and IRF7(K373/375R). Again, the triple mutant IRF7(K444/446/452R) completely loses the ability to respond to LMP1 stimulation (Fig. 7A). Further, we studied the activities of these mutants in response to the IRF7 kinase IKKε (48). The results were similar to those obtained with LMP1 (Fig. 7B).

• Open in new tab
• Download powerpoint

FIG. 7.

Transactivation response of IRF7 ubiquitination-deficient mutants to LMP1 and to IKKε. (A, B, and C) 293 cells in 24-well plates were transfected with 25 ng (A) or 50 ng (B and C) of IRF7 or its K→R mutants, 25 ng LMP1 or 100 ng IKKε or the vector control, 25 ng IFN-α4-Luc, and 10 ng Renilla. Luciferase assays were performed 24 h after transfection. (A) IRF7 functional ubiquitination sites are required for its activation in response to LMP1 (solid bars). The expression levels of IRF7, IRF7(K373/375R), and IRF7(K444/446/452R) are shown at the bottom. WT, wild type; αIRF7, anti-IRF7. (B) IRF7 functional ubiquitination sites are required for its activation in response to IKKε (solid bars). (C) The IRF7 ubiquitination-deficient mutant IRF7(K444/446/452R) does not respond to LMP1 and Ub.

Together, these results show that lysines 444, 446, and 452, but not K373 and K375, are key ubiquitination sites that are responsible for IRF7 activation. More importantly, since these ubiquitination-deficient mutants have little or dramatically reduced transactivation ability in response to IKKε as well as to LMP1, ubiquitination on these sites seems to be a prelude to IRF7 phosphorylation rather than simply enhancing its transcriptional activity.

Ubiquitination of IRF7 is independent of its functional phosphorylation sites.K48-linked ubiquitination is usually preceded by phosphorylation (26). To check whether K63-linked ubiquitination of IRF7 is dependent on the two major phosphorylation sites Ser 477/479, we checked the ubiquitination abilities of IRF7, IRF7(S477D/S479D) [designated IRF7(2D)], IRF7(S477A/S479A) [designated IRF7(2A)] (which has the two major phosphorylation sites Ser 477/479 mutated to alanines [37]), and IRF7(1-470) in response to LMP1 with “denatured” IP. Wild-type IRF7, as well as the two phosphorylation-deficient mutants IRF7(2A) and IRF7(1-470), are all ubiquitinated in the presence of LMP1 and K63onlyUb, and the phosphorylation-deficient mutants may have even stronger capacity for ubiquitination. However, ubiquitination of IRF7(2D) is not detectable under our experimental conditions (Fig. 8A). To assess this in a relatively endogenous system, we made 293 cells stably expressing Flag-tagged versions of these constructs. LMP1 and Ub expression plasmids were transfected in these stable cell lines. Similar results were observed (Fig. 8B). These data indicate that LMP1 can stimulate ubiquitination of IRF7 independently of its C-terminal functional phosphorylation sites and suggest that phosphorylation may negatively regulate K63-linked ubiquitination.

• Open in new tab
• Download powerpoint

FIG. 8.

Ubiquitination of IRF7 is independent of its C-terminal functional phosphorylation sites. (A) 293 cells in 60-mm dishes were transfected with 0.5 μg Flag-IRF7 or its mutants, together with 0.2 μg LMP1 and 0.5 μg HA-K63onlyUb. Cells were collected 48 h after transfection for “denatured” IP with anti-Flag (αFlag) and blotting with anti-HA or anti-Flag antibodies. IB, immunoblotting. (B) 293 cells stably expressing the indicated proteins in 60-mm dishes were transfected with 0.2 μg LMP1 and 0.5 μg HA-K63Ub expression plasmids. Cells were collected 48 h after transfection, and IP was performed with denatured lysates with anti-Flag and blotting with anti-HA or anti-Flag antibodies.