TABLE 1.

Analysis of the functionality of localization element variants isolated from the three-hybrid screens: interaction with She2p and localization function

Localization elementTypeSequenceaLacZb (% of WT)Localizationc (%)
E1WTGACTATGTTAAAATACGCGAAGAAGTGGCTCATTTCAAGCCATTAAGTATACCCAACTTAACTAATAATC175
8GACTATGTTAAGATACACGCACAAGTGGCTCATTTCAAGCCATTAGGTATCCGGAAATTAACTAATAATC4.266
12GACTATGTTAAGATACGCGAAAAAGTGGCTCATTTCAAGCCATTAAGTATACCCAACTTAACTAATAATC10.170.5
26GACTATGTTAAGATACGCAAAAGAGTGGCTCATTTCAAGCCATTAAGTATACCCAACTTAACTAATAATC3.476
33GACTATGTTAACATACACGA TTAAGTGGCTCATTTCAAGCCATTACGTATACTCGACTTAACTAATAATC9.563.5
43GACTATGTTAACATACGCTAAGGAGTGGCTCATTTCAAGCCATTATGTATTGCTAAATTAACTAATAATC3.065
E2AWTTTGCGAATAGAGACATTCTATCGAACAATTCCAAATCTAATGTAAGGAAACC ATCTAAGAACAAAATCTC172
10TTGCGAATAGAGACATTCTATCGAACAATTCCAAATCTAATGTAAGGAATTT GGG TAAGAACAAAATCTC10.169
12TTGCGAATAGAGACATTCTAACGAAGGATTCCAAATCTAATGTAAGGAATCGTTG GCAGAACAAAATCTC9.274
34TTGCGAATAGAGACATTCTACCGAAGAATTCCAAATCTAATGTAAGGAAACC ATC TAAGAACAAAATCTC7.073.5
48TTGCGAATAGAGACATTCTATCGAACAATTCCAAATCTAATGTAAGGAACGG AATCAAGAACAAAATCTC8.672
61TTGCGAATAGAGACATTCTATCGAAAACTTCCAAATCTAATGTAAGGAAGTGTGC GTAGAACAAAATCTC1.579
73TTGCGAATAGAGACATTCTAACGAACACTTCCAAATCTAATGTAAGGAAGTT AGC ATAGAACAAAATCTC7.075
E2B/D1WTTGCATCTTCATCTCCATCTCCCTCCACACCGACGAAAAGTGGCAAGATGAGATCAAGATCATCCTCACCTG173
5TGCATCTTCATCTCCATCTACATCCACACCGACGAACAGTGGCAAGATGAGATCAAGATCATCCTCACCTG1.168
12TGCATCTTCATCTCCATCTCCCTCCACACCGACGTTACGTGGCAAGATGAGATCAAGATCATCCTCACCTG1.465
69TGCATCTTCATCTCCATCTACCTCCACATCGACGAAAAGTGGCAAGATGAGATCAAGATCATCCTCACCTG1.271
87TGCATCTTCATCTCCATCTCCTTCCACACCGACGAAAAGTGGCGAGATGAGATCAAGATCATCCTCACCTG0.787
106TGCATCTTCATCTCCATCTCACTCCACCCCGACGTAAAGTGGCAAGATGAGATCAAGATCATCCTCACCTG0.469
E3WTAGAGAATTGATACATGGATAACTGAATCTCTTTCAACTAATAAGAGACATTATCACG AAA CAA TTGTACA167
3AGAGAATTGATACAAGGATAACTGAATCTCTTTCAACTAATAAGAGACATTATCTCG TAT ATG TTGTACA2.969
20AGAGAATTGATACACCGATAACTGAATCTCTTTCAACTAATAAGAGACATTATCACG GCG CTT ATGTACA1.687
30AGAGAATTGATACATGGATAACTGAATCTCTTTCAACTAATAAGAGACATTATCTCA TCA AAT ATGTACA1.268
38AGAGAATTGATACATTGATAACTGAATCTCTTTCAACTAATAAGAGACATTATCACG AAA CAA TTGTACA3.474
42AGAGAATTGATACAAGGATAACTGAATCTCTTTCAACTAATAAGAGACATTATCCCG ACA TAC TTGTACA6.164
  • a Randomized positions are underlined. Mutated positions are indicated in italics.

  • b β-Galactosidase activity in a three-hybrid assay, normalized to the wild-type (WT) element.

  • c Percentage of localization of a reporter lacZ mRNA fused to the localization element sequence.