TABLE 2.

Primer sets for PCR amplifications used in ChIP assays and Northern blots

Assay and geneUpper primerLower primer
ChIP
    Negative controls
        POL1 GCCGCTCGAAATGGTACATCGCAATTCCTGGCGCTTTCT
        RPO21 GTTCGTTGATCGTACCTTACCTCATGATAAGACCTTCACGACCACCC
    Promoter genes
        FET3 AGTACGCTGAGTCGCCGATAACGAGAATAAGAGCACCTGCAAA
        FTR1 GTGCGCGAATACTGCTGGTTTACTGCTGCGACGGTGCT
        MRS4 TAACCCACAGGAATCGCTACTTTGGTGTTCTTGCCTTTCAGTCTTC
        SMF3 ACATTGAAGCCACGACAAATGAACAGGGTGCGGTTACCATGA
Northern blot (Coding sequences)
    FET3 TTCTTGGACGATTTCTACTTGCAACTCTGGCAAACTTCTA
    FTR1 TCCGTGCTGCTATCGTTTTTATCCCACCCATTGTCCAGTT
    MRS4 ATGGAGCATTCTTTGATGTTATTAGCCACTATCCTTGGTT
    SMF3 CTGAAAACTGTCGTCATAATAGGACAAGACCACTTGAGA