TABLE 1.

PCR primers

GenePrimer (5′-3′)Size (bp)
ForwardReverse
Cldn6/FLAGATGGCCTCTACTGGTCTGCATCACTTATCGTCGTCGTCCTTG585
GAPDHCTCAACTACATGGTCTACATAGTAGACTCCACGACATACT180
Atf4GATATCTCTGAAGGAGACAGGACCTCTTCTATCAGGTCTT462
Atf6GAGTATATGCTAGGACTGGACTGAGAGACTCTGTTGTGTT449
Eif2ak4GATTACCTACACAGCAACTCGTCTCAATGTAGTCTTGTCC449
Eif2s1GATGACAAGTACAAGAGACCCATCTGTATCTGTGACCACT433
Ern1CTAACGCCTACTCTGTATGTGTGTGTTGTCTGAAGTCTG406
Hspa5ATAAGAGAGAGGGAGAGAAGCTTCAGATCAGAGTCTTCC422