TABLE 1.

Oligonucleotides used in this study

Purpose and nameProtein or other element(s) (strand)Plasmid or DNASequence
Integration
    PEX2ProtA (sense)pProtA/HU5′ GATGCCTGTGGATCCTCTGGGAGACTGACCGCCTCACCAGTGTACGGTGAAGCTCAAAAACTTATT 3′
ProtA (antisense)pProtA/HU5′ ATAGTATACACATATATAGAGATACAAGCGAGGGAACGGGGCCCATTTTACTTATAATACAGTTTTTTAG 3′
    PEX10ProtA (sense)pProtA/HU5′ GCAGACAACACTGTCAACCACAGGAAATTCTGGTCCTGCGGCAAGGTGAAGCTCAAAAACTTATT 3′
ProtA (antisense)pProtA/HU5′ GGCCTGTGGACAATGCTAAAAGAGTAGTCAAATTATTGATTATTTACTTATAATACAGTTTTTTAG 3′
    PEX12ProtA (sense)pProtA/HU5′ ACATACAACAAACACACGAATAAATGGGAAGTTGTGACAGGTATTAGGAAGCTACTAATCGGTGAAGCTCAAAAACTTATT 3′
ProtA (antisense)pProtA/HU5′ TGCTTGTAACACAACTGCAAAGAGGTGGAACAAGTGACATGAATTACCTGCTGGATAACATTTACTTATAATACAGTTTTTTAG 3′
    PEX2 1 to 221ProtA (sense)pProtA/HU5′ AAAAAACCACCAAGGTCTCGTTCTACGACTACTTATAAGACAGTTGGTGAAGCTCAAAAACTTATT 3′
ProtA (antisense)pProtA/HU5′ AGCGATCTGGTATGGGTTGGTTGGAAAACCGCCGCAACGGGGGCAATTTTACTTATAATACAGTTTTTTAG 3′
    PEX10 1 to 238ProtA (sense)pProtA/HU5′ TCTACGCTCGGGTCCTGGATTTATGGGAGAAAAAGGACCAATGATGGTGAAGCTCAAAAACTTATT 3′
ProtA (antisense)pProtA/HU5′ ATGTTCTGAACGCTCCTGTAGACCAACAGACGACCTAGTAATTGAATTTTACTTATAATACAGTTTTTTAG 3′
    PEX12 1 to 333ProtA (sense)pProtA/HU5′ TCACATAGTGACAAAACGGAAGATAAAGAGGGAGTTTCTGAGGCCGGTGAAGCTCAAAAACTTATT3′
ProtA (antisense)pProtA/HU5′ TTCCAATACACAGGGGTTTTGTACAGTTTTTTCGCAAACGGGACAATTTTACTTATAATACAGTTTTTTAG 3′
    PEX2TEV-ProtA (sense)pYM85′ GATGCCTGTGGATCCTCTGGGAGACTGACCGCCTCACCAGTGTACCGTACGCTGCAGGTCGAC 3′
ProtA (antisense)pYM85′ ATAGTATACACATATATAGAGATACAAGCGAGGGAACGGGGCCCTATCGATGAATTCGAGCTCG 3′
    PEX4HA (sense)pYM35′ AAAGTACTTCCTAGCAGAAAGAGAGCGGATC 3′
HA (antisense)pYM35′ CCCATTGTTTGCCATTCGAACACATCCATCC 3′
Cloning
    UBC7ORFa plus EcoRI (sense)Genomic DNA5′ GAATTCATGTCGAAAACCGCTCAG 3′
ORF plus NotI (antisense)Genomic DNA5′ GCGGCCGCTCAGAATCCTAATGATTT 3′
  • a ORF, open reading frame.