TABLE 1.

Sequences of the primers used for semiquantitative RT-PCRa

PrimerSequence (5′→3′)
ForwardReverse
CyclophilinTGGAGAGCACCAAGACAGACATGCCGGAGTCGACAATGAT
Apo BGCCCATTGTGGACAAGTTGATCCCAGGACTTGGAGGTCTTGGA
Apo A4GACTACTTCAGCCAAAACAGTTGGAAAGCTGCCTTTCAGGTTCTCCT
Axin2GAGAGTGAGCGGCAGAGCCGGCTGACTCGTTCTCCT
CckTGATTTCCCCATCCAAAGCGCTTCTGCAGGGACTACCG
Cdh-1TCCTTGTTCGGCTATGTGTCGGCATGCACCTAAGAATCAG
Cdx 1TCCGAGCTGGCTGCTAACCGGTTCTGGAACCAGATCTTT
Cdx 2CACCATCAGGAGGAAAAGTGACTGCGGTTCTGAAACCAAAT
Claudin-2GGCTGTTAGGCACATCCATTGGCACCAACATAGGAACTC
Claudin-3AAGCCGAATGGACAAAGAACTGGCAAGTAGCTGCAGTG
Claudin-4CGCTACTCTTGCCATTACGACTCAGCACACCATGACTTG
Claudin-7AGGGTCTGCTCTGGTCCTTGTACGCAGCTTTGCTTTCA
Claudin-12GTCCTCTCCTTTCTGGCAACATGTCGATTTCAATGGCAGA
Claudin-15GCTTCTTCATGTCAGCCCTGTTCTTGGAGAGATCCATGTTGC
Crypt 1TCAAGAGGCTGCAAAGGAAGAACCCTTTCTGCAGGTTCCATT
Cyclin D1AAGTTCATTTCCAACCCACCCTGGAAAGAAAGTGCGTTGTGC
Dsk2TGCAGTTCCCATTCGAGTTACAGACAGATTGATGCCCGGGAAACACTACAGACTAAT
EBP50AGGTCAATGGTGTCTGCATGTGCTGAAGGGCTCAGGCAAG
F11rCGAGGGGAAAGCCGGGAGGAAACTGTTGTTCCGCATAGGGAGCTGTGATCTGGCTGTTAT
FABP-ITTACCAGAAACCTCTCGGACATTACCAGAAACCTCTCGGACA
GcgCACGCCCTTCAAGACACAGGTCCTCATGCGCTTCTGTC
GipCAGGTAGGAGGAGAAGACCTCACCTAGATTGTGTCCCCTAGCC
Gjb 1*GATGAGAAGTCCTCTTTCATCTGTAACGGTCATAGCAGACGCTGTTG
Hes 1TCAACACGACACCGGACAAATTATTCTTGCCCTTCGCCTC
HNF-1alphaAGAACCTCAGCCCAGAGGAGTGTGCTGCTGCAAGTACGA
HNF-1betaATCCCCAGCAATCTCAGAACGCTTGGGAGGTGTTGAGG
HNF-4alphaCAGTGTCGTTACTGCAGGC (exon3)GATGGGAGAGGTGATCTGTTG (exon5)
HNF-4gammaCTGCTGTTGCTGCTGCCACAGTGTGGACATGGGACC
Klf4CGGGAAGGGAGAAGACACTGAGTTCCTCACGCCAACG
Lgr5CTTCACTCGGTGCAGTGCTCAGCCAGCTACCAAATAGGTG
Math 1*TGCGATCTCCGAGTGAGAGCTCTTCTGCAAGGTCTGATTTTT
Mmp7TTCTGCTTTGTGTGTCTGCTGCCTTCTTTGTTTTAGAGTCATGAGG
MttpGGCAGTGCTTTTTCTCTGCTTGAGAGGCCAGTTGTGTGAC
Muc 2GCTGACGAGTGGTTGGTGAATGGATGAGGTGGCAGACAGGAGAC
Muc 3CGTGGTCAACTGCGAGAATGGCGGCTCTATCTCTACGCTCTCC
Muc 4CAGCAGCCAGTGGGGACAGCTCAGACACGCCAGGGAACTC
c-mycGACAAGAGGCGGACACACAAGGATGTAGGCGGCTTTT
Neuro-DGCATGCACGGGCTGAACGCGGGATGCACCGGGAAGGAAG
Ngn 3CTTCACAAGAAGTCTGAGAACACCAGCTGCGCATAGCGGACCACAGCTTC
OclnGCTGTGATGTGTGTGAGCTGGACGGTCTACCTGGAGGAAC
P21TCCACAGCGATATCCAGACAGGACATCACCAGGATTGGAC
P27TCAAACGTGAGAGTGTCTAACGGAGGGGCTTATGATTCTGAAAGTCG
Pkp2CGCCTCACCCTGCCACGCTATGCTCGCGGGCGGTTCTGCTCTGCGTGCTTTGA
SctGCTGTGGTCGAACACTCAGAGAGACAGGGACCCATCCAG
Sox 9CAGCAAGACTCTGGGCAAGTCCACGAAGGGTCTCTTCTC
SstCCCAGACTCCGTCAGTTTCTGGGCATCATTCTCTGTCTGG
Tcf 4CAACGAACACAGCGAATGTTTTAGGAGCGCTCAGGTCTGT
Tff3CCTGGTTGCTGGGTCCTCTGGCCACGGTTGTTACACTGTC
ZO1AGGACACCAAAGCATGTGAGGGCATTCCTGCTGGTTACA
  • a The primers were designed in different exons of the corresponding gene, except in those marked with an asterisk, which indicates that the gene has no intron.