TABLE 1.

Summary of primer sequences

UseGeneDirectionSequence (5′-3′)Positions in cDNA
RT-PCR probeMst1ForwardCTG TGG GGC TGG TTC TGT AT349-766
ReverseTGT GGG AGG AGG GTT TGT AG
Mst2ForwardTGG TCC CTT GGC ATTACT TC746-1275
ReverseTCC TCC TCC TCC TCT TCC TC
Whole-mount in situ hybridization probeMst1ForwardAATTGGATCCTTGAGCACGGTGACAC889-1118
ReverseAATTGGATCCCGGATCTCTTCCATTTC
Mst2ForwardAATTGGTCCATGGAGCAGCCGCCGGC1-314
ReverseAATTGGATCCCCCGCTCCACAGTACTC