TABLE 2.

Primer sequences used for real-time PCR analyses

GenePrimer sequence
ForwardReverse
RpL32 CAGTCGGATCGATATGCTAAGCTGTTAACCGATGTTGGGCATCAGATACT
Rab1 CCACTGACAACGCTAGCAAAAATTTAAATACGCACACGCA
Rab2 CCAACACAATGCGGAATAACCGACATAGAAAGTGGAAATTG
Rab3 TTGTCCTTATATTCGTGTGTGGCGGGTATGCAGATGTGTGTT
Rab4 TCCGTAACTTACAGACACGACATGTTCATCCTCTAGATCAGATCC
Rab5 ACTAAACATGAGAAGAAAGCGCTTGCAACTATCACACGTGTCC
Rab6 GTGCATTTCCGATACCCCGCCGCAAACAGAACAGAA
Rab7 AGTCAAATTTTGCACGCAACCCAAAGAGCATGAGAATTCATAA
Rab8 GCGTCCTTCTCGAAGAGGTGTGTGCGGCAAAGAACAA
Rab9 GATGTGGACCAGGACAAGTTTCCGCATATATTCGATACGGTA
Rab10 GAAAATCCGAGCTGCAGTGCGGTAAATCATTTGGTGTGG
Rab11 AACAACATCCGGCTGTAGTTAGAAAATCCGAGCTGCAGTG
Rab14 TTTTATCGCCCAAACAGTGTTCATTTAGCACGAGCACTG
Rab18 ACATCACCAGCAGGGACAGAACACGTAGACGCGCTTG
Rab19 CATAGAGCGACATGGGAACAGGCTCGATTCGCTGATGT
Rab21 GAAGGTTGTGTGGGCAAGACGCTCAGGAAGGGCAAGA
Rab23 CCAACCGTTGGATGCAACAACTCCTATTCGGCTTACATG
Rab26 CACAACGTGCCCTTCATGCTTTCGAGTGCCCCACTT
Rab27 TGCCGTACATCGAGACGAAGCGAAACACACTTAGATTCG
Rab30 TGACGTGATCGTTTGCCTTCCAAAGATTGCACATTAATCG
Rab32 TTCTAGTCATTGGTGAACTGGGTGTTACGTTAAAACCCTAAGCA
Rab35 TACAATAACAAGAGCGACCGGCAGATCAGAGCTTTCGTTT
Rab39 TCCAAGAGACAAATCCCTCGATCCATCCTCCGCCTTATAT
Rab40 TTTACACAGTAAAGCATGCACCTGCTTCTCTTGCTGAATTCG
RabX1 CGAATATGGGCTCAAGGGCCCAGCTGTCATTAAGAACTAA
RabX2 TGTTTAAGGTTCTCGTCCTGGGGCTGATCGGGTTGTGAA
RabX3 TGCTCGTTTACGACATAACGACATTCGCGCCACTCTTGGC
RabX4 TTAACCTCGATGGAGTACCCATCCCTTAACTGGTTTGCATC
RabX5 AGGCCACTCAGGCATCTGTTCTAGCAAGTACAGCCACTTT
RabX6 TAATAGGAATTCCATCGATTGGAGTATTACGTGCAATAAG
CecA2 ATTAGATAGTCATCGTGGTTGTGTTGGTCAGCACACT
Dpt ATGCAGTTCACCATTGCCGTCTCCAGCTCGGTTCTGAGTTG
Dfn CGCTTTTGCTCTGCTTGCTTGCTAGGTCGCATGTGGCTCGCTTC
Mtk GCATCAATCAATTCCCGCCACCCGGCCTCGTATCGAAAATGGG