Table 1.

Primers for amplifying hTR sequences

PrimerDescriptionSequencea
T7HTR+1T7 promoter plus +1 to +20cgtaatacgactcactataGGGTTGCGGAGGGTGGGCCT
T7HTR+33T7 promoter plus +33 to +55cgtaatacgactcactatagGGCCATTTTTTGTCTAACCCTAA
T7HTR+44T7 promoter plus +44 to +63cgtaatacgactcactataggGTCTAACCCTAACTGAGAAG
T7HTR+58T7 promoter plus +58 to +74cgtaatacgactcactataggGAGAAGGGCGTAGGCGC
T7HTR+164T7 promoter plus +164 to +185cgtaatacgactcactatagggAGCAAACAAAAAATGTCAGCTG
T7HTR+206T7 promoter plus +206 to +221cgtaatacgactcactataGGGGACCTGCGGCGGG
T7HTR+250T7 promoter plus +250 to +265cgtaatacgactcactatagGGAGGCCGCGGTCGGC
T7HTRmt+33T7 promoter plus +33 to +64cgtaatacgactcactatagGGCCATTTTTTGTCaAACCCaAACTGAGAAGG
(TTTGGG template mutant)
HTR+451Complement of +432 to +451GCATGTGTGAGCCGAGTCCT
HTR+354Complement of +337 to +354CCTGAACCTCGCCCTCGC
HTR+325Complement of +306 to +325CCGCGGCTGACAGAGCCCAA
HTR+300Complement of +281 to +300CGCGGTGGCAGTGGGTGCCT
HTR+280Complement of +261 to +280CCGGAGAAGCCCCGGGCCGA
HTR+205Complement of +189 to +205GGGAGGGGCGAACGGGC
HTR+163Complement of +143 to +163CTAGAATGAACGGTGGAAGGC
HTR+147Complement of +130 to +147AAGGCGGCAGGCCGAGGC
HTR+104Complement of +87 to +104GAAAAACAGCGCGCGGGG
HTR+73Complement of +55 to +73CGCCTACGCCCTTCTCAGT
  • a Sequences corresponding to hTR are in uppercase; the T7 promoter (taatacgactcactataggg) is underlined; the first G of the triplet GGG is the first transcribed nucleotide (+1). Nucleotide mismatches in T7HTRmt+33 are denoted by lowercase italic letters.