Table 1.

Strain names, constructions, and relevant genotypesa

Strain nameConstruction or referenceRelevant genotype
W303a 37 Wild type, a mating type
W303α 37 Wild type, α mating type
SPY40 27; derived from W303a by transformation a tel1::URA3
SPY40FRIsolation of 5FOAr SPY40 derivative a tel1::ura3
Y604Provided by Y. Sanchez and S. Elledge a mec1-21
PG28.8Transformation of W303a withXhoI-SalI fragment of pJL202b a ura3Δ::HIS3
PG30.1Transformation of PG28.8 with PCR fragmentc to replace TEL1with URA3 a ura3Δ::HIS3 tel1Δ::URA3
PG30.1FRIsolation of 5FOAr derivative of PG30.1 a ura3Δ::HIS3 tel1Δ::ura3
KRY20aTransformation of PG30.1FR withHpaI-BamHI fragment of pDTK103d to generateade3::hisG/URA3/hisG allele; isolation of 5FOAr derivative to generateade3::hisG allele a ura3Δ::HIS3 tel1Δ::ura3 ade3::hisG
KRY20αMating-type switch of KRY20a by using plasmid pGAL-HO e αura3Δ::HIS3 tel1Δ::ura3 ade3::hisG
KRY70Transformation of W303a withBamHI-treated pDTK102,f followed by isolation of 5FOAr derivative a rad52::hisG
JMY73Transformation of W303a with PCR fragmentg to generatesml1::HIS3 a sml1::HIS3
KRY300Cross of W303a and W303αWild-type diploid, W303 background
KRY227Transformation of KRY300 with 6-kb SacI fragment of pPG47h a /α tel1::URA3/TEL1
KRY228Transformation of KRY300 with 2-kb XhoI fragment of pBLUE61::LEU2 i a /α tlc1::LEU2/TLC1
KRY301Spore derived from KRY227 a tel1::URA3
KRY302Spore derived from KRY228α tlc1::LEU2
KRY229Cross of KRY301 and KRY302 a /α tel1::URA3/TEL1 tlc1::LEU2/TLC1
KRY235Transformation of KRY228 with URA3 PCR fragmentj a /α tlc1::LEU2/TLC1 ura3/URA3
KRY303Spore derived from KRY235α tlc1::LEU2 URA3
KRY236Cross of KRY303 and SPY40FR a /α tel1::ura3/TEL1 tlc1::LEU2/TLC1
ura3/URA3
JMY300Cross of Y604 with KRY20α a /α tel1::ura3/TEL1 mec1-21/MEC1
ade3::hisG/ADE3 ura3::HIS3/ura3
JMY300-1aSpore derived from JMY300α tel1::ura3 mec1-21
JMY300-2aSpore derived from JMY300 a tel1::ura3 mec1-21
JMY300-3aSpore derived from JMY300 a tel1::ura3 mec1-21 ura3::HIS3
JMY300-3aSFast-growing survivor derived from JMY300-3a a tel1::ura3 mec1-21 ura3::HIS3
KRY242Cross of KRY70 to JMY300-1a a /α tel1::ura3/TEL1 mec1-21/MEC1
rad52::hisG/RAD52
KRY246Cross of W303α to JMY300-3aS a /α tel1::ura3/TEL1 mec1-21/MEC1
JMY301Cross of W303α to JMY300-2a a /α tel1::ura3/TEL1 mec1-21/MEC1
JMY302Transformation of JMY301 with PCR fragmentg to generatesml1::HIS3 a /α tel1::ura3/TEL1 mec1-21/MEC1
sml1::HIS3/SML1
JMY303Cross of JMY73 to JMY300-1a a /α tel1::ura3/TEL1 mec1-21/MEC1
sml1::HIS3/SML1
KRY306Spore derived from KRY229αtel1::URA3 tlc1::LEU2
KRY238Cross of Y604 to KRY306 a /α tel1::URA3/TEL1 mec1-21/MEC1
tlc1::LEU2/TLC1
AMY125Provided by A. MorrisonWild type, α mating type
EAS16Provided by E. Sia, constructed by using plasmid pGAL-HO e Wild type, a mating type
EAS20Cross of AMY125 to EAS16Wild-type diploid, AMY125 background
KRY230Transformation of EAS20 with 6-kbSacI fragment of pPG47h a /α tel1::URA3/TEL1
KRY231Transformation of EAS20 with 2-kb XhoI fragment of pBLUE61::LEU2 i a /α tlc1::LEU2/TLC1
KRY304Spore derived from KRY230α tel1::URA3
KRY305Spore derived from KRY231 a tlc1::LEU2
KRY232Cross of KRY304 and KRY305 a /α tel1::URA3/TEL1 tlc1::LEU2/TLC1
  • a Most of the strains used are isogenic (except for changes introduced by transformation) with W303a (a leu2-3,112 his3-11,15 ura3-1 ade2-1 trp1-1 can1-100). Strains listed below AMY125 are isogenic with AMY125 (α ade5-1 his7-2 leu2-3,112 trp1-289 ura3-52) except for changes introduced by transformation. All genes that differ from those of the progenitor genotype are listed. 5FOAr, 5-fluorooroate resistant.

  • b Plasmid pJL202 (provided by J. Li) contains a yeast DNA fragment in which the coding sequence of URA3 is replaced with HIS3 (30).

  • c The PCR fragment used to replace the coding sequence of TEL1 with URA3 was generated by using the primers 5′CCTTCAAAGAAAAGGGAAATCAGTGTAACATAGACGGATTGTACTGAGAGTGCACC and 5′CAAAAAAAAGAAGTATAAAGCATCTGCATAGCAATTACTGTGCGGTATTTCACACCG. The URA3 gene within pRS306 (32) was amplified with these primers, and the resulting DNA fragment used for transformation (41).

  • d Plasmid pDTK103 (provided by D. Kirkpatrick) was derived from pDTK101 (BamHI-SalI fragment containing ADE3 inserted intoBamHI/SalI-treated pNEB193) by insertion of aBamHI-BglII fragment containinghisG-URA3-hisG sequences derived from pNKY51 (1) into a BglII site within the ADE3 gene.

  • e Use of plasmid pGAL-HO to do a mating-type switch is described by Herskowitz and Jensen (10).

  • f Plasmid pDTK102 (provided by D. Kirkpatrick) was constructed by ligating a BamHI-BglII fragment containing hisG-URA3-hisG sequences derived from pNKY51 (1) to BglII-treated pSM20 (provided by D. Schild). The resulting plasmid (pDTK102) has arad52::hisG-URA3-hisG gene.

  • g The primers 5′CTTACGGTCTCACTAACCTCTCTTCAACTGCTCAATAATTTCCCGGGATCCGCTGCACGGTCCTG and 5′GTATGAAAGGAACTTTAGAAGTCCATTTCCTCGACCTTACCCTGGGCCTCGTTCAGAATGACACG (46) were used to amplify the HIS3 gene of yeast strain AS4 (35), generating a DNA fragment with thesml1::HIS3 allele.

  • h Reference 6.

  • i Reference 33.

  • j The primers 5′GCTACATATAAGGAACGTGC and 5′TTTGCTGGCCGCATCTTCTC were used to amplify theURA3 gene in plasmid pRS306 (32).