Table 1.

Synthetic oligonucleotides used in this study

NameSequenceaPosition (RAP1)bSite(s)c
U/S1AGTACGAGATCTAGAAGGGGCAATATG BglII
U/S2ACTATAAGATCTTGCCCGGGTGGCGGCAGA1780–1809 (rev) BglII,SmaI
2666−TGGTATAGCGAAGCTTATGGAAGCAGC1876–1902 (rev) HindIII
2640+GCTGCTTCCGGATCCTACGCTATACC1876–1901 BamHI
3262−CTTAATTCAATCGATCATAACAGG1274–2497 (rev) ClaI
pRH1CGTTTATGAGGTTAACAAGTTTGG1251–1274
pRH2CCAAACTTGTTAACCTCATAAACG1251–1274 (rev)
pRH3GAGGTTGACGCGTTTGGTAAATTG1258–1281
pRH4CAATTTACCAAACGCGTCAACCTC1258–1281 (rev)
1797+GGGCAAAGGTCCATGATTTCGAGG1033–1058
pRH5CCAAACTTGTCGACCTCATAAACG1251–1274 (rev) SalI
pRH6GACGATGGAGTCGACATAAAGACT1291–1314 SalI
AD695−TCTGTTGTTGAGATCTATGGTGGAAA2077–2102 (rev) BglII
pRHKL1CATTCTACCGAAATCGATAAAGAG ClaI
pRHKL2GAATGGGTTGCATGCTCAAGTGCG(rev) SphI
pRHSUZRCTACCACCATCGATAAA ClaI
pRHSU2GTGTGTTGCATGCATCTCTGC(rev) SphI
pRHZR2GTGGGTTGCATGCGATTCACC(rev) SphI
pRHKL4GGTAGATCTCTCCCGGGTTTTTAGGG(rev) SmaI
pRH7GTTTGCCACCATCGATTAAAAGG1318–1341 ClaI
pRH8CCTTTAATCGATGGTGGCAAAAC1318–1341 (rev) ClaI
2500−TTGGTGAGGTTCTTCATC1719–1736 (rev)
2544+TCTGCCGCCACCCGGGCAAGAAAT1779–1802 SmaI
628−GTATAGCGTAAGCCCGGGAAGCAGC1875–1899 (rev) SmaI
662−GTGGATACTCCCGGGGCAAAC1978–1998 (rev) SmaI
RDSFGAAGGACCCGGGATGAGTAATTG2469–2491
RDSR2CTTGCCCGGGTCGTAGGAATTCTAGTAG(rev)
  • a The DNA sequences are shown in the 5′ to 3′ direction.

  • b The position indicated corresponds to the position of the sequence in the RAP1 coding region, relative to the ATG. (rev), reverse PCR primer.

  • c Where a restriction enzyme site has been introduced by use of the primer, the site is indicated.