Table 1.

Sequences of the oligonucleotides used in this study

NamePurposeSequence
F3BForward primer for hTR5′TCTAACCCTAACTGAGAAGG GCGTAG
R3CReverse primer for hTR5′GTTTGCTCTAGAATGAACGG TGGAAG
RT1Top strand to construct competitor for hTR5′CGCCATTTATTCAGGCCGGG
RT2Bottom strand to construct competitor for hTR5′CGCCCGGCCTGAATAAATGG