Table 1.

Oligonucleotides for Pip plasmid constructions

OligonucleotideSequence
RPip1-420GCGGGATCCGTTTTGTTGAGCAAAGTAATA
RPip1-300GCGGGATCCCTGTCCATTGTCGTCCGGGTA
RPip1-240GCGGGATCCCCTTATGCTTGGCTCAATGGG
RPip1-207GCGGGATCCTCAGCCTTGCCAGTGGTGGCC
RPip1-182GCGGGATCCTCAGGCATAATCCCTCCAGCT
RPip1-175GCGGGATCCTCAATAAGGTGCTGTCATGGG
RPip1-134GCGGGATCCTCATTTTTTGGCTCCCTCTGG
FPipΔ1-100GCGGAATTCCTGAACAAGAGCAATGAC
FPipΔ1-140GCGGAATTCTTGGATGACACACAGATG
FPipΔ1-160GCGGAATTCCTGCCAGCCCAGCAGGTT
FPipΔ1-180GCGGAATTCTATGCCCCTGACCAGTCA
FEcoPipATGGCGGAATTCATGGCCATCGATATCGATCCC
FPipΔ140-160GGAGCAAAGCAGCTCCTGCCAGCCCAGCAGGTTCAT
RPipΔ140-160CTGCTGGGCTGGCAGGAGCTGCTTTGCTCCTTTTTT
FPipΔ140-180GGAGCAAAGCAGCTCTATGCCCCTGACCAGTCACAC
RPipΔ140-180TGACTGGTCAGGGGCGAGCTGCTTTGCTCCTTTTTT
FPipΔ140-207GGAGCAAAGCAGCTCCCATCTTGTGAAAATGGTTGC
RPipΔ140-207ATTTTCACAAGATGGGAGCTGCTTTGCTCCTTTTTT
FPipVP16GAGGGAGCCAAAAAAATGGCACCCAAGAAGAAG
RXbaVP16GCGTCTAGAAATTCGAGCTAGCTTCTA
RVP16PipCTTCTTGGGTGCCATTTTTTTGGCTCCCTCTG
GAL4CATCATCATCGGAAGAG
hcmvGCAGAGCTCGTTTAGTG