Table 2.

Oligonucleotides for reporter plasmid construction and for‚ÄČEMSA

OligonucleotideSequence
FCore m7.1AGAACCTTAGGCTACGCTGTTGCTTTCG
RCore m7.1CGAAAGCAACAGCGTAGCCTAAGGTTCT
FCore m7.2CCTTAGGCACATAGTGTGCTTTCGCTCC
RCore m7.2GGAGCGAAAGCACACTATGTGCCTAAGG
FCore m7.3AGGCACATCTGTGCAGTTCGCTCCCATC
RCore m7.3GATGGGAGCGAACTGCACAGATGTGCCT
FCore m7.4ACATCTGTTGCTGGATCTCCCATCCTCC
RCore m7.4GGAGGATGGGAGATCCAGCAACAGATGT
FCore m7.5CTGTTGCTTTCGAGAACATCCTCCTCCA
RCore m7.5TGGAGGAGGATGTTCTCGAAAGCAACAG
FCore m7.6TGCTTTCGCTCCACGACTCCTCCAACAG
RCore m7.6CTGTTGGAGGAGTCGTGGAGCGAAAGCA
Oligo 7GATCCACATCTGTTGCTTTCGCTCCCATCCAGTGTAGACAACGAAAGCGAGGGTAGGTCTAG
m7.1GATCCTACGCTGTTGCTTTCGCTCCCATCCAGATGCGACAACGAAAGCGAGGGTAGGTCTAG
m7.2GATCCACATAGTGTGCTTTCGCTCCCATCCAGTGTATCACACGAAAGCGAGGGTAGGTCTAG
m7.3GATCCACATCTGTGCAGTTCGCTCCCATCCAGTGTAGACACGTCAAGCGAGGGTAGGTCTAG
m7.4GATCCACATCTGTTGCTGGATCTCCCATCCAGTGTAGACAACGACCTAGAGGGTAGGTCTAG
m7.5GATCCACATCTGTTGCTTTCGAGAACATCCAGTGTAGACAACGAAAGCTCTTGTAGGTCTAG
m7.6GATCCACATCTGTTGCTTTCGCTCCACGACAGTGTAGACAACGAAAGCGAGGTGCTGTCTAG