Table 1.

Oligonucleotides used

NameDescriptionSequencea
RoxOctaWTbRex-1 promoter from −234 to −204GATTCAGAAGAGGCATTTGCATAACTGAGCA
RoxOcta* Rex-1 promoter with WT Rox-1 binding site; mutations in the octamer sequence (same mutations as in the previously described pBoct-CAT)GATTCAGAAGAGGCATgTtCATAACTGAGCA
Rox*Octa Rex-1 promoter with mutations in the Rox-1 binding site; WT octamer sequence (same mutations as in pRox*Oct-CAT)GATTCctcctctGCATTTGCATAACTGAGCA
mRox1 Rex-1 promoter with mutations in 2 base pairs in the Rox-1 binding site; WT octamer sequenceGATgaAGAAGAGGCATTTGCATAACTGAGCA
mRox2GATTCctAAGAGGCATTTGCATAACTGAGCA
mRox3GATTCAGccGAGGCATTTGCATAACTGAGCA
mRox4GATTCAGAAtcGGCATTTGCATAACTGAGCA
mRox5GATTCAGAAGAttCATTTGCATAACTGAGCA
mRox6GATTCAGAAGAGtaATTTGCATAACTGAGCA
mRox1,5,6 Rex-1 promoter with mutations in 5 base pairs in the Rox-1 binding site; WT octamer sequenceGATgaAGAAGAttaATTTGCATAACTGAGCA
OctaOctamer sequence from the μ-chain enhancer used for Fig.1BGATCCGTACTAATTTGCATTTCTA
Octa-3′ Rex-1 promoter with octamer and WT sequence 3′ of itGGCATTTGCATAACTGAGCA
Octa*-3′ Rex-1promoter with mutated octamer and WT sequences 3′ of itGGCcagTtCATAACTGAGCA
TCRα enhancerNonspecific oligonucleotide used as a competitorCGTAGGGCACCCTTTGAAGCTCTCCC
  • a Lowercase letters indicate mutations; boldface letters indicate the octamer motif.

  • b WT, wild type.