Table 2.

PCR primers

PrimerSequence
PTC2N5′ACCGGATCCAGAAAAATGGGACAAATTCTATC3′
PTC2C5′AACGGCCGGCACCGAATTCTTAACCCATTTGCTGTCCACCAGTCATGCTAGCCATTCCTTGCAAGTGGGAACGGCCGGC3′
PTC2174N5′GTGGAATTCGATGGCTTCGTAGAAATGGAT3′
PTC2312C5′AGAACGGAATTCTCAGCGGTGGGCCTTGGACTT3′
PTC2355C5′GGAAGGATCCTCAGTGGTCGCGAGTGAATTTGTC3′
ptc2E37A/D38AN5′GCAATGCAAGGGTGGCGGATGTCAATGGCGGCGTCACACATTCTA3′
ptc2E37A/D38AC5′CTTTGTCAAAACATTAGGCTCTAGAATGTGTGACGCCGCCATTGACA3′
ptc2D234AN5′GATTACGATAGGGACGAGTTTGTAATCTTAGCCTGTGCAGGTATCTG3′
ptc2D234AC5′AATCTTGGGAAGTCAAACAATCCCAGATACCTGCACAGGCTAA3′
IRE1N5′ACTTGTCGACATGCGTCTACTTCGAA3′
IRE1C5′GCTCTAGATTATGAATACAAAAATTCACG3′
ACT1N5′GGTTCTAGATTCTCCACCACTGCTGAAAGA3′
ACT1C5′GTCAATACCGGCAGATTCC3′
HAC1N5′AAATCTAGAAGAGTCGACGACGCTACCTG3′
HAC1C5′AAATTCGAATACCCTCTTGCGATTGTCTTC3′