Table 1.

Oligonucleotides used in 3B deletion derivative construction, RNase H treatment, and BIE constructsa

OligonucleotideSequenceaRestriction enzymeGene (positions)
3BA upper strand5′GGC GCTAGCAATTAGCCTGGACGAGAGGCGT 3′ NheI bicoid (4007–4029)
3BA or 3BD lower strand5′ GATTACGCCCAAGAGAAACATT 3′ bicoid (4473–4452)
3BB or 3BC upper strand5′ CGACTACGCCGCTAGCAGTTCG 3′HA1 DNA cassette (47–65), bicoid (2765–2767)
3BB lower strand5′ GGG ACGCGTCTAATTGAAGCAGTAGGCAAAC 3′ MluI bicoid (4012–3991)
3BC lower strand5′ GGG ACGCGTCTATCCGCCGATGCCGATGCCACAC 3′ MluIStop codon; bicoid (3136–3115)
3BD upper strand5′GCC GCTAGCCCTTGCGCCATCGCCGTTGGCG 3′ NheI bicoid (3137–3158)
ΔNRE5′ GTACAATCAGGAACAACAGTGGT 3′ bicoid (4079–4057)
BIES5′ CCGGC CCTGGACGAGAGGCGTGTTAGAGAGTTTCATTAGCTTTAGGTT G 3′ NgoMI bicoid (4013–4055)
BIEA5′ CCGGC AACCTAAAGCTAATGAAACTCTCTAACACGCCTCTCGTCCAGG G 3′ NgoMI bicoid (4055–4013)
  • a Underlining indicates added nucleotides. Boldface type indicates endonuclease restriction sites.