TABLE 2

Sequences of PCR primers

GeneSense primerAntisense primerAmplicon size (bp)
OVEGCAGGGAAATGTATAGGAAGTTTTCAAGTTTCTGTTTGAAAATA1,533
ROSA26RAAAGTCGCTCTGAGGGAGCGGGAGAAATGGATATG603 (wild type)
AAAGTCGCTCTGAGTTGTTAT303 (R26R)
CreGGCTGCCACGACCAAGTGACCGTGAGATATCTTTAACCCTGATC253
Gata3TCAGGGCACTAAGGGTTGTTAACTTGAATTCCATCCATGAGACACACAA160 (wild type), 210 (flox)
lacZTTCGCCAGCTGGCGTAATAGCGAAGAGGCTAGGTCACGTTGGTGTAGATGGGCGCATCG217