TABLE 1

qPCR primer sequences

GeneSpeciesForwardReverse
Pcsk1MouseAGTTGGAGGCATAAGAATGCTGGCCTTCTGGGCTAGTCTGC
Pcsk2MouseAGAGAGACCCCAGGATAAAGATGCTTGCCCAGTGTTGAACAGGT
Pcsk3MouseTAGCAGGCAATTATGACCCTGGTAAGCTACACCTACGCCACAG
Pcsk4MouseCTTTCGCTCTCCTACAGCCGAGTTGTTGTAGCCTTGGCCG
Pcsk5HumanGAGGGACCCACAGTTTCATTTCTGGGCACGACTGAAGTCATAA
Pcsk6MouseCAGGCGCGAAGTGACTCTCGACCGACAGCGACTGTTCTT
Pcsk7MouseAGAGAGTCTGACGCAACAGGTATGCCCAGTAGGCTGGACAA
Pcsk8MouseCTGGTGGTTTTGCTCTGTGGGGCTGTGAAGTATCCGTTGAAAG
Pcsk9MouseGAGACCCAGAGGCTACAGATTAATGTACTCCACATGGGGCAA
Gdf15MouseCTGGCAATGCCTGAACAACGGGTCGGGACTTGGTTCTGAG
36b4MouseAGATGCAGCAGATCCGCATGTTCTTGCCCATCAGCACC