TABLE 1

Primer sequences

GenePrimer sequences (5′–3′)
Sox5CCTGAAGCAGAGGAAGATGG; GGCTCTCAGGAGTCCCTTTT
Sox6ACCAGTGACTTCTGGGTGCT; AGATACGCTTAGCACTTGAGT
Mef2cCTTCCTCTCCATCCGCTGTA; GTCTGTCCAAACCTCTATACA
Bmp-2TGGAAGTGGCCCATTTAGAG; TGACGCTTTTCTCGTTTGTG