TABLE 1

Primer sequences used in this study

Purpose and primer designationaSequence (5′→3′)bProduct size (bp)
ForwardReverse
For qPCR (human)
    ULK1GGCAAGTTCGAGTTCTCCCGCGACCTCCAAATCGTGCTTCT97
    ATG3GATGGCGGATGGGTAGATACATCTTCACATAGTGCTGAGCAATC125
    ATG4BGGTGTGGACAGATGATCTTTGCCCAACTCCCATTTGCGCTATC172
    ATG5GTTTTGGGCCATCAATCGGAATCTCCTAGTGTGTGCAACTGT159
    ATG6AGGTTGAGAAAGGCGAGACAAATTGTGAGGACACCCAAGC196
    ATG7ATGATCCCTGTAACTTAGCCCACACGGAAGCAAACAACTTCAAC114
    ATG8AACATGAGCGAGTTGGTCAAGGCTCGTAGATGTCCGCGAT127
    ATG10TACGCAACAGGAACATCCAAAACAACTGGCCCTACAATGC157
    ATG12TAGAGCGAACACGAACCATCCCACTGCCAAAACACTCATAGAGA153
    ATG14GCGCCAAATGCGTTCAGAGAGTCGGCTTAACCTTTCCTTCT91
    ATG16ATGCGCGGATTGTCTCAGGGGTCCACTCATTACACATTGCTCT138
    HuRAACTACGTGACCGCGAAGGCGCCCAAACCGAGAGAACA194
    GAPDHTGCACCACCAACTGCTTAGCGGCATGGACTGTGGTCATGAG87
    β-ActinGGACTTCGAGCAAGAGATGGAGCACTGTGTTGGCGTACAG234
    RPL6AGATTACGGAGCAGCGCAAGATTGGCAAACACAGATCGCAGGTAGCCC106
For BPD assay (human)
    ATG5-3UCCAAGCTTCTAATACGACTCACTATAGGGAGACTGTGTTCTTTACACACTACACGTGTGAAGAAATGTGCTATTAATCAGTG554
    ATG5-3U1ATG5-3U forward primer sequenceACACTAGCTTGGAAGGAATGG181
    ATG5-3U2CCAAGCTTCTAATACGACTCACTATAGGGAGACAGACACGATCATGGTTTTAGATG5-3U reverse primer sequence186
    ATG12-3UCCAAGCTTCTAATACGACTCACTATAGGGAGAAACATCTTCATTGTCAGTTCTCACAACAAGACCGAAACGCTG1,443
    ATG12-3U1ATG12-3U forward primer sequenceCCACAGTTATGTGATTGGGACT467
    ATG12-3U2CCAAGCTTCTAATACGACTCACTATAGGGAGAGATGAGTAAACCCAGTAGCATCTTCAGGCTGGTCTCAAACTTGT341
    ATG12-3U3CCAAGCTTCTAATACGACTCACTATAGGGAGACCACTGAGGGTTCAGATGATAGATG12-3U reverse primer sequence269
    ATG16-3UCCAAGCTTCTAATACGACTCACTATAGGGAGAACTCCCGAACTACAGACCCTATTTACAATCAAGTTCTGTTGGCC846
    ATG16-3U1ATG16-3U forward primer sequenceTTCACACATCCTCTCCCACCTC237
    ATG16-3U2CCAAGCTTCTAATACGACTCACTATAGGGAGAGATGCCCTTGGTGCTTTAGTGCATG16-3U reverse primer sequence461
    GAPDH-3UCCAAGCTTCTAATACGACTCACTATAGGGAGACCTCAACGACCACTTTGTCAGGTTGAGCACAGGGTACTTTAT335
For cloning (human)
    ATG5-3UaaaaAGATCTTAACTGTGTTCTTTACACACTACACGaaaaGGTACCTGTGAAGAAATGTGCTATTAATCAGTG546
    ATG12-3UaaaaAGATCTTAAAACATCTTCATTGTCAGTTCTCAaaaaGGTACCCAACAAGACCGAAACGCTG1,435
    ATG16-3UaaaaAGATCTTAAACTCCCGAACTACAGACCCaaaaGGTACCTATTTACAATCAAGTTCTGTTGGCC839
  • a GAPDH, glyceraldehyde-3-phosphate dehydrogenase.

  • b Lowercase letters are extra nucleotides for efficient cleavage by restriction enzymes.