TABLE 2

PCR primers used for validation and bisulfite sequencing

Primer function and nameSequence
Genomic primers for empty/filled L1 validation reactions
    LineageProgenitor_Chr11_fwdAGGAAACAGTGAGGGGAAGC
    LineageProgenitor_Chr11_revTGAGGCCCAGGAGTCATATC
    Donor_Chr3_fwdTGTATGACAGTAAAATAATGGGTAGATGA
    Donor_Chr3_revCTGGCCTCTTCACTGCATTT
    DeNovo_Chr1_fwdCTGGTAACCCCAGAATGACG
    DeNovo_Chr1_revATCCTGCCTCAGCGAACTTA
    Non-ref_Chr3_fwdTTGTGGGAAGGCAAAATGAT
    Non-ref_Chr3_revTATTCAATCCCAACCCAGGA
L1-specific primers for validation of 5′ and 3′ L1-genome junctions
    hL1_273_revACCCGATTTTCCAGGTGCGT
    hL1_ACshort_fwdAGATATACCTAATGCTAGATGACAC
NotI/L1-genome junction-spanning primers for cloning full-length L1s
    LineageProgenitor_Chr11_NotI_fwdCAAGCGGCCGCTTACATTTTTAAAGAATTGTAGGGGAG
    Donor_Chr3_NotI_fwdTAAAGCGGCCGCAACAGAATGAGTAAATAATGGAGGG
    DeNovo_Chr1_NotI_fwdTTCGCGGCCGCATTAAAGAAATGACATCTGAAATAATGGA
    Non-ref_Chr3_NotI_fwdCAACGCGGCCGCTTAAAGTTAAAGACACGG
L1-specific primers for sequencing full-length L1s
    L1_452_fwdGCCCAGGCTTGCTTAGGTA
    L1_1020_fwdTGATTTTGACGAGCTGAGAGAA
    L1_1532_fwdCCTCGAGAAGAGCAACTCCA
    L1_1966_fwdGCAAAATCACCAGCTAACATCA
    L1_2494_fwdAACTCAGCTCTGCACCAAGC
    L1_3014_fwdAAATCAGAGCAGAACTGAAGGAAA
    L1_3502_fwdGAGGCCAGCATCATTCTGATA
    L1_4022_fwdCAATCAGGCAGGAGAAGGAA
    L1_4472_fwdTCCCCATCAAGCTACCAATG
    L1_4973_fwdTGTCCAAAACACCAAAAGCA
    L1_5492_fwdTACCATTTGACCCAGCCATC
Primers for amplification of L1 promoters from bisulfite converted DNA
    L1_Bis-LPGATTTGTTTTTGGATTGTAAAATGGTT
    L1_Bis-DonorTGGGTAGATGAACAGATAAGTAAA
    L1_BiS-DNGTTATTTGATAGTATTTTAATGAAGATT
    L1_Bis-FTAGGGAGTGTTAGATAGTGG
    L1_Bis-RACTATAATAAACTCCACCCAAT