TABLE 4

Sequences of PCR primers used in this study

Primer nameSequence (5′–3′)Amplicon
yOH58TACTACAAGAGAAAGGCCATCTCCt1
yOH59AATGCAGCGCAGACAGCACAGTTt1
QJK61TTGAGATACAAAATATTACAAGAAGTCCTGt2
QJK62GCGTTCTTCTGTATCTGAAGATAGTGt2
QJK63TCATGTATCAAGATTACTAGCGCAAGTGt5
QJK64TTCTATTCTTATGTACCGTTCCGCCt5
yOH62GCAAGCGAAGTTGTTCCCGTTATt7
yOH63GTTCGGTCACTTAGAGGATATAATTGt7
QJK69CTCTATTTCTCAACAAGTAATTGGTTGTTTt8
QJK70GCCCCTGTGTGTTCTCGTTATGTt8
yOH64GACAAGAAAGATAACGACACAGTGAt9
yOH65GGCCCTCGTATAGTCTCTTTTCt9
R197GAGACCAGGTTTATTCAACCGGTAACt0
LOU120GGGTGTCACCGAATAACGTGATt0
GRO39TAAGACAATTGTGGACAACAAAGCAAAOCA4
GRO40ATTTATTAATGTCAAAAGCCGCTGAGGOCA4
yOH66TCACTCATATAAACCGAACCCTTCCCEN3
yOH67GGATTTTCCATATTGTTTGGCGCTGCEN3