TABLE 1

Primer sequences for real-time quantitative PCR

GeneOrientationaSequence (5′→3′)
MafaFGCTGCTGCACCCGCTTGAAG
RAGGCCACCACGTGCGCTTGG
Ins1FCCAGCTATAATCAGAGACCA
RGGGCCTTAGTTGCAGTAGTT
Ins2FAGGAAGCCTATCTTCCAGGT
RATTCATTGCAGAGGGGTAGG
GcgFAGGGACCTTTACCAGTGATGT
RAATGGCGACTTCTTTGGGAA
HprtFTTGTTGTTGGATATGCCCTTGACTA
RAGGCAGATGGCCACAGGACTA
  • a F, forward; R, reverse.