Table 1.

Sequences of PCR NS5A oligonucleotidesa

ConstructSensebAntisensent
NS5A 1b-wt5′ TAAGCTTATGGGC5′ CAAGCTTGGATCC6260–7598
1973-2419TCCGGCTCGTGGCTTTAGGACATTGAGC
NS5A5′CATATGGGCTCCGG5′GTCGACCGCAGACA6260–6965
1973-2208CTCGTGGCTAACTGGCTAGCTGA
NS5A5′GAATTCCCTTCCTT5′GTCGACCTCCGCCG6966–7165
2209-2274GAAGGCAACATGCGAACGGATAC
NS5A5′ CCTTCCATGGCCCA5′ ATCGGATCCTTATA6877–7094
2180-2251CATTACAGCAGAGACGCCACCTTATTCTCTGA
  • a Amino acid and nucleotide (nt) positions correspond to the PCR-amplified region. Numbering is based on the prototypic HCV-J sequence (36).

  • b Cloning restriction sites (described in text) are underlined.