Table 1.

Primers used for real-time quantitative PCR

Method and targetSequence (5′–3′)
SenseAntisense
RT-PCR
    εY-globinACCCTCATCAATGGCCTGTGGACATGGGCTTTGACCCTTGGG
    βH1-globinATCATGGGAAACCCCCGGAGGGTGAATTCCTTGGCAAAATGAGT
    Adult β-globinTCTGCTATCATGGGTAATGCCAAAGAAGGCAGCCTGTGCAGCG
    18S rRNAGCTGCTGGCACCAGACTTCGGCTACCACATCCAAGG
ChIP assay
    εY promoterGAAAGAATACCTCCATATCTAATGTGCATCTGCATTATTCTTTGAAGCTATTGGT
    βH1 promoterGGACCCCACCCCTGTCTTTTACCCCTCCCCAGGACTCT
    βmajor promoterGAAGCCTGATTCCGTAGAGCCAACTGATCCTACCTCACCTTATATGC
    βH1-βmajor intergenicCGGGATGGGCATTAAAGGTAAACAACCTGTGTCAGAAGCAGATG
    SCAPCGCGGTCCGGTGTTTGGGAAAGGTAGGAGTTGAGAGGTGAA
    Human ε promoterCACAAACTTAGTGTCCATCCATCACCCCTGTTCTCCATGGTACTTAAAAG
    Human γ promoterGCAAATATCTGTCTGAAACGGGTGGAACTGCTGAAGGGTGCTT
    Human β promoterGAGGGTTTGAAGTCCAACTCCTAACAGGGTGAGGTCTAAGTGATGACA