Table 2.

Oligonucleotides used in this study

OligonucleotideOligonucleotide IDSequence (5′-3′)Purpose(s)
snR13 1 up1309TTATAAATGGCATCTCAAATCGTCChIP, Northern probe
snR13 1 down1310GGTCAGATAAAAGTAAAAAAAGGTAGCChIP, Northern probe, RT-PCR
snR13 1 top2435CCTTTTTATATGATGAATATGAGTGCRT-PCR
snR13 2 up1311CTGACCTTTTAACTTCCCCGTAGChIP, RT-PCR
snR13 2 down1312CTGTCGCTTCCGTGTCTCTTGTCCTGChIP, RT-PCR
snR13 3 up1313CACGGAAGCGACAGAAAGACAGGGAGChIP
snR13 3 down1314CTAGAGGGAATGTATGTTGTTGAAGChIP
snR13 4 up1315GAGCATCTGCTTTCCTTTCACChIP
snR13 4 down1316ATCACGGCGCCTCATCTTTGChIP
snR13 5 up1317AAAACCAAGAAAAGGATAAAGAGChIP
snR13 5 down1318TCGGTGTCTACAAAATGATACGCChIP
Pho23 up1447GATCCGCCTCTTCGCCCAGCACAmplify deletion cassette
Pho23 down1448CACACCACCCACTGTACGGCGATTAGAmplify deletion cassette
Rad6 up1449AGCAACCATGAAACACTATATTCGAmplify deletion cassette
Rad6 down1450ACGGCGAGCTTGGTGTCATTATGAmplify deletion cassette
Set1 up1695GTATTATATAAAATCGATGTCGCATTAGTCAmplify deletion cassette
Set1 down1696CCATCAAGTCACGAACATATTGTAATGAmplify deletion cassette
rDNA #14 up1707CCGGGGCCTAGTTTAGAGAGNorthern probe
rDNA #15 down1710TCCCCACTGTTCACTGTTCANorthern probe
Yng1 up2254GGCGCTCGACCCTCTCCAmplify deletion cassette
Yng1 down2255CATCATGGTTAAAGGTTGTATCCCAmplify deletion cassette
Rtr1 up2256CAGAAGTGGTCAAAAGCAATGGAmplify deletion cassette
Rtr1 down2257GAACCAAAACTCTGAAGCAACACTAmplify deletion cassette
Set1 H422A up2096ATAACAGACCTGTTTTAGCTGTCTCCAAAATATTTGTTGIntroduce H422A mutation
Set1 H422A down2097CAACAAATATTTTGGAGACAGCTAAAACAGGTCTGTTATIntroduce H422A mutation
Set1 H1017K up2098TAGCCCGTTTCATTAATAAATGTTGTGATCCAAATTGTACIntroduce H1017K mutation
Set1 H1017K down2099GTACAATTTGGATCACAACATTTATTAATGAAACGGGCTAIntroduce H1017K mutation
snR3 1 up2353GTACTAATCCACCGCATTAGACAGTRT-PCR
snR3 1 down2354CTTCTGACACTCGAGTCTCATTCART-PCR
snR3 2 up2355ATCCGTATGGGTGCAATCAAAGRT-PCR
snR3 2 down2356CGAGTGTCTGGCCGAATGTCRT-PCR
snR9 1 up2357GAACTTTCTACGCCTTTTCCTCTATGRT-PCR
snR9 1 down2358GTCTGAAGGACTAATGATAGGTGGGRT-PCR
snR9 2 up2359AAGCTTTCTTAACTCTTGCATCACTACRT-PCR
snR9 2 down2360CGATATAGGGCAGAACAAGGAGTRT-PCR
snR71 1 up2361GATGATAACCTTCTCAGCTCACTCART-PCR
snR71 1 down2362GGTCAGATAAATTGATGAATGTTGGRT-PCR
snR71 2 up2363ATCTTACATGAAACTTAAACACGATACATRT-PCR
snR71 2 down2364CACGGCCTGTACACGAACTATRT-PCR
snR190 1 up2365GGCCCTGATGATAATGGTGTCTRT-PCR
snR190 1 down2366GGCTCAGATCTGCATGTGTTGTATRT-PCR
snR128 1 up2367GATCACGGTGATGAAAGACTGGRT-PCR
snR128 1 down2368CTACAGTATACGATCACTCAGACATCCTART-PCR
snR128 2 up2369CTTTATCAAACCAGCTTACCAACATTRT-PCR
snR128 2 down2370TGGTCAAAGGAATCGAACAAGART-PCR
FMP40 up2347GGTTGAAGTTACCCAAGCGGATCCRT-PCR, ChIP
FMP40 down2348CAATTCGGCTCATTTGCTGCACAGCRT-PCR, ChIP
RPR2 up2351GACTCGAGCTCAGTGAGCCGTTTATTATTACRT-PCR
RPR2 down2352GCCATCAGAGGGTTAGAAACACCTATTGTAAGRT-PCR
NEL025C up2349GTAGTCGCCAACAATCATTTCGATACAACTTGRT-PCR, ChIP
NEL025C down2350CAACCGCTGTTGTCAAACAAGACTATAGGRT-PCR, ChIP