Table 1.

Primers used for screening targeted and transgenic mice

PrimeraSequenceTarget (nt)
A>TCTCAAGTGTTCTCTGTAGTAGTGGGG5522–5548b
<ECAAGGCCAAGAGGACC9147–9132b
<DGAGAGCTAGCAATACG9147–9132 of E64Dc
<GGAGCTAGCAATACGC9147–9131 of E64Gc
D>GATGAAGATGACGTATTGCTAGCTCTC9121–9147 of E64Dc
G>GATGAAGATGGCGTATTGCTAGCTCTC9121–9147 of E64Gc
<AGGCAAGGCTATTGCATTGCTC10072–10052b
U>GGGTTCATGGGTAAGACAAGC6633–6653b
<PTGCTATACGAAGTTATGGCGC5′ of the 5′ loxP site
P>CAGCACCAGGATATCAGGATCCG5′ of the 5′ loxP site
<ITGCAGGGCCTTGTACTGTACTTATGAG12702–12676,b intron 6
6>AGGACAAGTCTTGGCGTG11558–11575,b exon 6
Cre>CCAGGCGTTTTCTGAGCATACC102–123 of the Cre CDSd
<CreGGCAACACCATTTTTTCTGACCC744–722 of the Cre CDSd
p53>TGGAGGAGTCACAGTCGGATATCAG11–35 of the p53 CDSe
<p53CCTTCTTGGTCTTCAGGTAGCTGG1111–1088 of the p53 CDSe
  • a >, forward primer; <, reverse primer.

  • b Nucleotide range, counted from the start codon of the Aα gene (ENSMUST00000007708).

  • c See also Fig. 3.

  • d Based on the Cre coding sequence (accession number DQ023272). The PCR product was 642 bp.

  • e Based on the p53 coding sequence (accession number ENSMUST00000108658). Note that the CCSP-dnp53 transgene contains only part of the p53 coding region (amino acids 1 to 14 and 302 to 390), resulting in a PCR product of only 239 bp.