Table 1.

ChIP and NOMe-Seq primer sets used in this study

Primer application and nameSequence (5′ to 3′)
ForwardReverse
ChIP
    KLK3/PSAa
        R1GCCCACCTGTTTGTCAGTAACTCATGAACCTCATGCTGTCTGCTAAG
        R2CAGACAGCATGAGGTTCATGTTCATGTGCACAGCATCCACCTAGAC
        R3ATACTGGGACAACTTGCAAACCTCAGGCTTGCTTACTGTCCTAGATAA
        R4GGTGTTGCTGTCTTTGCTCAGAAGGTGGAAGGCTCTGGCTGAA
        R5TGCAGGACAGTCTCAACGTTCCACCCAGAAGTTCTGATCCCCA
    KLK2
        R1AGAAATTATGGCTGGATGTCTCTGGAGATTATGATGGGCTCCTGGT
        R2CCACAGCTAAGGAGGCAGCACCATCCACCTGAACTGCTCTGA
        R3GGTTGAAAGCAGACCTACTCTGGAGATCTAGGTTTGCTTACTGCCTTAG
        R4CCATCTTGCAAGGCTATCTGCTGTGTGTCTTCTGAGCAAAGGCAAT
        R5CTAACCAAGATTTCTAGGTCCAGTTCCACTCAAGCCCAGAAGTTCTGAT
    TMPRSS2
        R1CCCTGTTTGTGGGGCTGTTCCTGCCTCCCTCTGGGTTCTG
        R2CACTGCTGTCAACTCCACGGCTGTGTTCGGACCTGTTAGAGTTAT
        R3GTGGCCCACCACTTCCTCACCACACAGCAAGGCAGAGGACA
        R4TTAGACAACAAATGGCCACCTGGTTGGAGCTAGTGCTGCATGTC
        R5CTCTAACTACAGCCCAGGCAAGTAGCAAGGGCAGTTTAGCCAG
        R6CTCTAACTACAGCCCAGGCAAGTAGCAAGGGCAGTTTAGCCAG
NOMe-Seq
    KLK3/PSAa
        R1ATTTTTATTATGATATTAGGATTTTATTGTATTTCACCTTTTTTTTTCTAAATTATTATTTC
        R2AGAGTTTATGAGATTTTTGAGTTCTCACTCAAACCCAAAAATTCTAATC
    KLK2
        R1TTTAGATTTTGATTTTGAGGTTATTTTAGATTTTTCAATATTAAAAAACAATTTTCCATAATTCTCTTATATTTC
        R2TGGTAGAATTTATGAGATTTTTGGGTTCAAAAATTCTAATCCCCACCCATATC
    TMPRSS2
        R1TTATTTTGGTTTTTTTTAGTTTTATTAAATTTTAGTCTTATAACACTTCACCCATCTTTAACATATAC
        R2TTTTTTTTATTATTTAGGATTAATATTTTTATCCTATCTTTTATAATTCCCCTTTATAATCTATATTGT
    TMPRSS2 (single amplicon), R1TTTTGAAGTATTTGGGAAAATTCCATCTTTAACAAAAATCTTTAAATAACTTTTTCAAC
    GRP78, R1GAGAAGAAAAAGTTTAGATTTTATAGAAACACCCCAATAAATCAATC
  • a Enhancer/region.