Table 2

Primers used in real-time RT-PCR

DescriptionSequence
Gnas exon 1A forwardAGCTAACCCAAGGAGCACCTAA
Gnas exon 2 reverseGTTAAACCCATTAACATGCAGGA
Gnas exon 1 forwardAGAAGGACAAGCAGGTCTACCG
Gnas XL exon forwardATAAGAAACGCAGCAAGCTCATC
Gnas XL exon reverseCATGTAGTCCATCTTCTCCTCCT
Gnas N1 exon reverseGGACTGTAGCCATCATCTAGTGG
Leptin exon 2 forwardTGCCTATCCAGAAAGTCCAGGAT
Leptin exon 3 reverseTCATTGGCTATCTGCAGCACAT
Ucp1 exon 3 forwardACCACAGAAAGCTTGTCAACAC
Ucp1 exon 4 reverseCCCCTTCATGAGGTCATATGTTA