Table 1

Primers used for RT-PCR and qRT-PCR

PrimeraSequence
ForwardReverse
h-collagen α1(I)AGAGGCGAAGGCAACAGTCGGCAGGGCCAATGTCTAGTCC
h-collagen α2(I)CTTCGTGCCTAGCAACATGCTCAACACCATCTCTGCCTCG
h-actinGTGCGTGACATTAAGGAGAAGGAAGGTAGTTTCGTGGATGCC
h-fibronectinACCAACCTACGGATGACTCGGCTCATCATCTGGCCATTTT
m-collagen α1(I)GAGCGGAGAGTACTGGATCGTACTCGAACGGGAATCCATC
m-collagen α2(I)CTTCGTGCCTAGCAACATGCTCAACACCATCTCTGCCTCG
m-fibronectinAATGGAAAAGGGGAATGGACCTCGGTTGTCCTTCTTGCTC
m-actinCGTGCGTGACATCAAAGAGAAGCTGGATGCCACAGGATTCCATACC
h-GAPDHACCGGTTCCAGTAGGTACTGCTCACCGTCACTACCGTACC
  • a h, human; m, mouse.