TABLE 1

Sequence of primers used in quantitative genomic PCR, qRT-PCR, and genotyping

Gene or genomic elementSense primerAntisense primerAssay
Gata2ACCTGTGCAATGCCTGTGGGTTGCACAACAGGTGCCCGCTqRT-PCR
Gata3GGTGGACGTACTTTTTAACAT CGACCCTGACGGAGTTTCCGTAGqRT-PCR
Ae1 (Slc4a1)TATGGGGTCGCCCACATCTATAGGCCGAATCTGATCCTCGTAqRT-PCR
Ae4 (Slc4a9)CCAATTTCCTGGGCATCAGGGCATCGGGATGAACTTqRT-PCR
Aqp2CAGCTCGAAGGAAGGAGACAGCATTGGCACCCTGGTTCAqRT-PCR
Aqp3CTGGGGACCCTCATCCTTTGGTGAGGAAGCCACCATqRT-PCR
Aqp4TGGAGGATTGGGAGTCACCTGAACACCAACTGGAAAGTGAqRT-PCR
Creb1CCAAACTAGCAGTGGGCAGTCCCCATCCGTACCATTGTTqRT-PCR
NCC (Slc12a3)CCTCCATCACCAACTCACCTCCGCCCACTTGCTGTAGTAqRT-PCR
Nkcc2 (Slc12a1)ATGCCTCGTATGCCAAATCTCCCACATGTTGTAAATCCCATAqRT-PCR
Sglt1 (Slc5a1)CTGGCAGGCCGAAGTATGTTCCAATGTTACTGGCAAAGAGqRT-PCR
Sglt2 (Slc5a2)GCTGGATTTGAGTGGAATGCCGGTCAGATACACTGGCACAqRT-PCR
UmodCTCAGTGTCCAAGGCTGCTTGGAAACAACAGCAGCCAGATqRT-PCR
Avpr2GGTCTCGGTCATCCAGTAGCCTGGTGTCTACCACGTCTGCqRT-PCR
GapdhGTCGTGGAGTCTACTGGTGTCTTGAGATGATGACCCTTTTGGCqRT-PCR
Gata2floxAGGGACCGGGTACCATAACTCCTCTAACCCTTCCCTGTCCGenomic qPCR
Aqp2 promoterCGAGGAAAACAGAGACGTCAAAAGGCCTATCACCCCATCTTGenomic qPCR
G1-14.4 kbCAGGGCACAGCGAGTTTAGAGCCTGTCCTTGGAGCTTGTGAAGenomic qPCR
G1-3.8 kbCCCTTATCTATGCCTTCCCAGTGCAAGGCCCAGAAGTCGenomic qPCR
G2-2.8 kbGCCCTGTACAACCCCATTCTCTTGTTCCCGGCGAAGATAATGenomic qPCR
GATA2 floxTCCGTGGGACCTGTTTCCTTACGCCTGCGTCCTCCAACACCTCTAAGenotyping
GATA2 GFPCTGAAGTTCATCTGCACCACCGAAGTTGTACTCCAGCTTGTGCGenotyping
Pax8-rtTACCATGTCTAGACTGGACAAGACTCCAGGCCACATATGATTAGGenotyping
TRE-CreACGTTCACCGGCATCAACGTCTGCATTACCGGTCGATGCAGenotyping