TABLE 1

Real-time PCR primers used in this study

PrimerSequence
ForwardReverse
β-ActinGTTCCGATGCCCTGAGGCTCCAGACAGCACTGTGTTGGCA
AcadlTCTGGACTCCGGTTCTGCTTCTCTGTCTTGCGATCAGCTCTT
AcadmAGACGAAGCCACGAAGTATGCTCATCAGCTTCTCCACAGGGT
CebpaGGTGGACAAGAACAGCAACGATGTCCAGTTCACGGCTCAGCT
Cgi58ACGATTCCTTATGGGTGGGCCACACATAATGCCCCGCCCCGA
CideaCTTCCTCGGCTGTCTCAATGTGGGGGATGGCTGCTCTTCTGT
Cox8bCTCCCCCCTATCCTGCGGCTGACTATGGCTGAGATCCCCACA
Cyclophilin BAAGGTGCTCTTCGCCGCCGCCTGATGACACGATGGAACTTGCTGT
Fabp4ATGCCTTTGTGGGAACCTGGATCACCTTCCTGTCGTCTGCGG
Foxo1GTGGATGGTGAAGAGCGTGCCTTCCGCTCTTGCCTCCCTCTG
G0S2CCTCTCTTCCCACTGCACCCTGGCTGGCGGCTGTGAAAGGGC
Irf4AGCTAGAAAGAGACCAGACTTGCATGGAGTGGTAACGTGTTCAGGTAA
LipeCACAGAGACACCAGCCAACGCACTCCTGGTCGGTTGATGG
Plin2ACGACGACACCGATGAGTCCCGTGAGGACGCCATCGGACACT
Pnpla2ACGCCACTCACATCTACGGACAATCAGCAGGCAGGGTCTT
PparaGGCTGCTATAATTTGCTGTGGAGTGTGTACGAGCTGCGCATGC
PpargTGCGGAAGCCCTTTGGTGACTATGTCCTCGATGGGCTTCACGTTC
PpardCCGCAAGCCCTTCAGTGACATCATGCAGATGGAATTCTAGAGCCCGCA
Ppargc1aTCATCACCTACCGTTACACCTTATCAAAATCCAGAGAGTCAT
Prdm16AGTCGGACAACCATGCACTTTTCCTTGGGGCTCAGGTGTGGG
Pri-miR-145 ExpressionP1: GGTGGCTGCTGGGACTTGAACP2: GGGTCAGGAGCCAGCATGAAG
Pri-miR-145 ExpressionP3: GAGTGCAAAGGATGGGCGAGCP4: CTCCCCTGTTTGTGCCCCGCC
Pri-miR-145 RIPCCCTCCTGGGGATGTTAGGACGGTCTTGGGAGCTCTCTTC
Ucp1CACCTTCCCGCTGGACACTCCCTAGGACACCTTTATACCTAATGG