TABLE 1

Genotyping and qPCR primer sequences

PrimerPrimer sequence (5′ → 3′)
Sec23b F1ATAGACCAGGCTGGCCTCAGTC
Sec23b cgt B1CCACAACGGGTTCTTCTGTT
Sec23b cgt R1CGAGCACAGAGAGACCCAAT
Sec23b RCAAGTGAGTGCCTCCTCACA
Sec23b F2AACAGCCCAGGTGACTAGGA
Sec23b qPCR FCCCTACGTCTTTCAGATTGTCA
Sec23b qPCR RCGGGCAAAATGGTGTCTATAA
Sec24a qPCR FGAGCAGAGATGGAGCGTTCCT
Sec24a qPCR RTTCTTCCAACCCAAAGCATCA
Sec24b qPCR FGACCCGAGAAGGCGCTTT
Sec24b qPCR RTTTGCCAACCCAAATGTAGAAA
Sec24c qPCR FTTATGCGGGTTCGGACAAG
Sec24c qPCR RCTCATATAGAAAGCGCCAAAGAAAT
Sec24d qPCR FCTCATATAGAAAGCGCCAAAGAAAT
Sec24d qPCR RTCATGTACACAGGCAGCACCTT
Sar1a qPCR FTCGGTGGGCATGAGCAA
Sar1a qPCR RGCCATTAATCGCTGGGAGATAA
Sar1b qPCR FGGGTGGGCACGTGCAA
Sar1b qPCR RTGCCATTGATAGCAGGAAGGT
TRAPPC3 qPCR FGCACGGAGAGCAAGAAAATGA
TRAPPC3 qPCR RGGTGACAAGCGCTCCATAGG
Beta-actin qPCR FGATCTGGCACCACACCTTCT
Beta-actin qPCR RGGGGTGTTGAAGGTCTCAAA
GAPDH qPCR FTGTGTCCGTCGTGGATCTGA
GAPDH qPCR RACCACCTTCTTGATGTCATCATACTT