TABLE 1

siRNA sequences

Targeted transcriptPair of siRNA oligonucleotidessiRNA sequence
Ampka11stUCUCUUUCCUGAGGACCCAUCUUAU
AUAAGAUGGGUCCUCAGGAAAGAGA
2ndGACUCUUUCCUGGACGACCACCAUU
AAUGGUGGUCGUCCAGGAAAGAGUC
Lkb1 (Stk11)1stGGAGGAGGAGGAGGAAGACUUGUUU
AAACAAGUCUUCCUCCUCCUCCUCC
2ndGCAUCGACUCCACCGAGGUAAUCUA
UAGAUUACCUCGGUGGAGUCGAUGC
Pde8a1stCAUUGACGAGGUUGCUGCCCUCAUU
AAUGAGGGCAGCAACCUCGUCAAUG
2ndCCUUCAUGAUGUCCCACCACGGAUU
AAUCCGUGGUGGGACAUCAUGAAGG