TABLE 2

Sequences of the primers used in the qRT-PCRs

TranscriptSequence of the primer
ForwardReverse
Cdk12ACCTGTGGTCCTGCCTCCTGAGGGGGCCTCTTCTCTGGTG
Cited4CCGACCACCTGATGCTCGCCGGAAAGAGACCGGCGACCCG
Crebl2GAGCGAAGCCGGCAGAGTGCGCTTGCTCTGCTCCTCGCCA
cFosTGCCTGAGGCTTCCACCCCATGGCACAGAGCGGGAGGTCT
cJunGCACCTCCGCGCCAAGAACTAAGCCCTCCTGCTCGTCGGT
Nr0b1CGTGCTCTTTAACCCAGACCTTCCATGCTGACTGCACCAAT
Nr4a1AGGAGACCAAGACCTGTTGCTCGATCAGTGATGAGGACCA
Nr4a3CTCGGCTATGACCCCACGGCTTGGGTGGCGATGGGAGGCT
Pde8aGTGCAATTTGGCCCGATGAGGATGTCATGGAGTTTGTCCTGG
Ppme1CGTGGCATGGGTGGGCGATTAGGCCGAGTCTGCGTCTCCA
Rpl19CTGAAGGTCAAAGGGAATGTGGGACAGAGTCTTGATGATCTC
Scarb1GCTGCTGTTTGCTGCGCTCGGGGTCCACGCTCCCGGACTA
StarGTTCCTCGCTACGTTCAAGCGAAACACCTTGCCCACATCT