Table 2.

Sequences of palindromic oligonucleotides used in this studya

Mutant allele
(insertion length [bp])
Sequence
his4-70(70)5′ TCGAGTACTGTATGTGGATCAGGTAAGGTTGGGAGTCGACTCCCAACCTTACCTGATCCACATACAGTAC 3′
his4-100 (100)5′ TCGAGTACTGTATGTGGATCAGGTAAGGTTGGGAGTCGAGCGTGTCTATCTGCAGATAGACACGCTCGACTCCCAACCTTACCTGATCCACATACAGTAC 3′
his4-105 (105)5′ TCGAGTACTGTATGTGGATCAGGTAAGGTTGGGAGTCGAGCGTGTAATATCGGTCACCGATATTACACGCTCGACTCCCAACCTTACCTGATCCACATACAGTAC 3′
his4-108 (108)5′ TCGAGTACTGTATGTGGATCAGGTAAGGTTGGGAGTCGAGTCGGATGAATGTCTCTAGAGACATTCATCCGACTCGACTCCCAACCTTACCTGATCCACATACAGTAC 3′
his4-116 (116)5′ TCGAGTACTGTATGTGGATCAGGTAAGGTTGGGAGTCGAGCGTGTAATATCGGTCACAGATCTGTCACCGATATTACACGCTCGACTCCCAACCTTACCTGATCCACATACAGTAC 3′
his4-120 (120)5′ TCGAGTACTGTATGTGGATCAGGTAAGGTTGGGAGTCGAGCGTGTAATATCGGTCACTGAGATCTCAGTCACCGATATTACACGCTCGACTCCCAACCTTACCTGATCCACATACAGTAC 3′
his4-140a (140)5′ TCGAGTACTGTATGTGGATCAGGTAAGGTTGGGAGTCGAGCGTGTAATATCGGTCACTGCTAAAAGCGGAGATCTCCGCTTTTAGCAGTCACCGATATTACACGCTCGACTCCCAACCTTACCTGATCCACATACAGTAC 3′
  • a Each oligonucleotide contains aSalI-compatible 5′ TCGA 3′ sequence at the 5′ end. The restriction endonuclease site present at the center of symmetry of each oligonucleotide is in bold letters. The oligonucleotides were inserted at the SalI site within the HIS4 coding sequence as described in Materials and Methods.