Table 2.

Oligonucleotides

NameSte12p amino acidaSequence (5′ to 3′)
AO1215FGGTACCATGTCTAGAAGACCATCTAGTACAACA
AO7262FGGTACCATGCCCTCTCAAATTAATGATTTTATT
AO8309FGGTACCATGGACTATTTTCTTGTATCTGTTGAA
AO9351FGGTACCATGTCTCTTCTTAATAGATACCCCTAT
AO10403FGGTACCATGGACCCTACCAGCTACATGAAGTAT
AO11450FGGTACCATGCAATCTTACCCAAACGGAATGGTT
AO12500RGAATTCTCATTGTGGATACAGCATATTGTTATC
AO13547RGAATTCTCACTGCATGGAATTTGAACTTTGCAT
AO14594RGAATTCTCAATTTCCTTGTGAAGACTTCATTCC
AO15641RGAATTCTCAAGAATCTTCGTCACCAGCACTTGG
AO4688RGAATTCTCAGGTTGCATCTGGAAGGTTTTTATC
VT11FCTGGATCCATGAAAGTCCAAATAACCAATAGT
SBD121FCTGGATCCATGGAAAACGATGAAGTCAGTAAAGCT
AO2945FCTGGATCCATGTTCTTTTTAGCCACAGCG
VT2215RTCGAATTCTCATCTAGAATCTAAATGTTGAAGTAA
SDB2195RTCGAATTCTCATGAAAAAGATAAGGCGGGCTCATT
AO27170RTCGAATTCTCATTCCAACGCATCCG
  • a Terminal Ste12p amino acid residue encoded by amplified DNA fragments produced with the indicated oligonucleotide. Priming direction: F, forward; R, reverse.