TABLE 1

Oligonucleotides used for real-time PCR

GeneAccession no.Sequence (5′–3′)Size (bp)
ForwardReverse
RptorNM_028898.2TGGGTCTTCAACAAGAACTACACTTCTGGGCAAGTGGATGGTTT199
Runx2NM_001146038.2ATGATGACACTGCCACCTCTGATGAAATGCTTGGGAACTGC120
Sp7NM_130458.3ATGGCGTCCTCTCTGCTTGGTCCATTGGTGCTTGAGAAGG211
BglapNM_007541.3AAGCAGGAGGGCAATAAGGTTCAAGCCATACTGGTCTGATAGC142
Spp1NM_001204201.1AGCAAGAAACTCTTCCAAGCAAGATTCGTCAGATTCATCCGAGT130
SparcNM_009242.5ACTACATCGGACCATGCAAATACCGTACAAGGTGACCAGGACAT108
IbspNM_008318.3CAGTCCAGGGAGGCAGTGGGAAAGTGTGGAGTTCTCTG158
Col10a1NM_009925.4CATCTCCCAGCACCAGAATCGCTAGCAAGTGGGCCCTTTA142
Sox9NM_011448.4CACAAGAAAGACCACCCCGAGGACCCTGAGATTGCCCAGA209
Mmp13NM_008607.2AGCAGTTCCAAAGGCTACAACTCCTCGGAGACTGGTAATGGC269
Col2a1(II)NM_001113515.2GCGACCGGGAGCATATAACTGCCCTAATTTTCGGGCATCC290
ActbNM_007393.4TTGCTGACAGGATGCAGAAGAAGGGTGTAAAACGCAGCTC236
AlplNM_007431.3GCCTTACCAACTCTTTTGTGCGGCTACATTGGTGTTGAGCTT116
Gli1NM_010296.2TACCATGAGCCCTTCTTTAGGAGCATCATTGAACCCCGAGTAG116